ID: 1024673816

View in Genome Browser
Species Human (GRCh38)
Location 7:51620397-51620419
Sequence TCACTACTTTTCTCAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024673816_1024673818 9 Left 1024673816 7:51620397-51620419 CCACTGTTTGAGAAAAGTAGTGA No data
Right 1024673818 7:51620429-51620451 AGCAATTTCAAATCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024673816 Original CRISPR TCACTACTTTTCTCAAACAG TGG (reversed) Intergenic
No off target data available for this crispr