ID: 1024673863

View in Genome Browser
Species Human (GRCh38)
Location 7:51620814-51620836
Sequence ACCTATCTCTCCCAAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024673863_1024673869 8 Left 1024673863 7:51620814-51620836 CCAGGTGTTTGGGAGAGATAGGT No data
Right 1024673869 7:51620845-51620867 GTCACCAGCTTCCTTGGAAAGGG No data
1024673863_1024673866 2 Left 1024673863 7:51620814-51620836 CCAGGTGTTTGGGAGAGATAGGT No data
Right 1024673866 7:51620839-51620861 AGGCCAGTCACCAGCTTCCTTGG No data
1024673863_1024673868 7 Left 1024673863 7:51620814-51620836 CCAGGTGTTTGGGAGAGATAGGT No data
Right 1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG No data
1024673863_1024673871 12 Left 1024673863 7:51620814-51620836 CCAGGTGTTTGGGAGAGATAGGT No data
Right 1024673871 7:51620849-51620871 CCAGCTTCCTTGGAAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024673863 Original CRISPR ACCTATCTCTCCCAAACACC TGG (reversed) Intergenic
No off target data available for this crispr