ID: 1024673868

View in Genome Browser
Species Human (GRCh38)
Location 7:51620844-51620866
Sequence AGTCACCAGCTTCCTTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024673863_1024673868 7 Left 1024673863 7:51620814-51620836 CCAGGTGTTTGGGAGAGATAGGT No data
Right 1024673868 7:51620844-51620866 AGTCACCAGCTTCCTTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024673868 Original CRISPR AGTCACCAGCTTCCTTGGAA AGG Intergenic
No off target data available for this crispr