ID: 1024675945

View in Genome Browser
Species Human (GRCh38)
Location 7:51638074-51638096
Sequence GGGCTGGTTAAAGCAGCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024675940_1024675945 -2 Left 1024675940 7:51638053-51638075 CCTGCATGGGCATCGCCTGGAGG No data
Right 1024675945 7:51638074-51638096 GGGCTGGTTAAAGCAGCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024675945 Original CRISPR GGGCTGGTTAAAGCAGCTTG CGG Intergenic
No off target data available for this crispr