ID: 1024677254

View in Genome Browser
Species Human (GRCh38)
Location 7:51647779-51647801
Sequence TTGGATGAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024677254_1024677261 6 Left 1024677254 7:51647779-51647801 CCTTCCTCCTCCTCCTCATCCAA No data
Right 1024677261 7:51647808-51647830 TAAAAACTGTAATGCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024677254 Original CRISPR TTGGATGAGGAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr