ID: 1024677336

View in Genome Browser
Species Human (GRCh38)
Location 7:51648509-51648531
Sequence CTGCTGTCCCTCTTCAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024677326_1024677336 30 Left 1024677326 7:51648456-51648478 CCAGTAGGTCTGGCATCCCAAGG No data
Right 1024677336 7:51648509-51648531 CTGCTGTCCCTCTTCAATACAGG No data
1024677328_1024677336 14 Left 1024677328 7:51648472-51648494 CCCAAGGAGCACCTCAGTTTAAG No data
Right 1024677336 7:51648509-51648531 CTGCTGTCCCTCTTCAATACAGG No data
1024677329_1024677336 13 Left 1024677329 7:51648473-51648495 CCAAGGAGCACCTCAGTTTAAGG No data
Right 1024677336 7:51648509-51648531 CTGCTGTCCCTCTTCAATACAGG No data
1024677332_1024677336 3 Left 1024677332 7:51648483-51648505 CCTCAGTTTAAGGAGGATCACAG No data
Right 1024677336 7:51648509-51648531 CTGCTGTCCCTCTTCAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024677336 Original CRISPR CTGCTGTCCCTCTTCAATAC AGG Intergenic
No off target data available for this crispr