ID: 1024677929

View in Genome Browser
Species Human (GRCh38)
Location 7:51654647-51654669
Sequence AGGGGTATCCCCTCTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024677924_1024677929 -2 Left 1024677924 7:51654626-51654648 CCGAGGTGCTGTTGGGACCTCAG No data
Right 1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG No data
1024677923_1024677929 4 Left 1024677923 7:51654620-51654642 CCTGATCCGAGGTGCTGTTGGGA No data
Right 1024677929 7:51654647-51654669 AGGGGTATCCCCTCTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024677929 Original CRISPR AGGGGTATCCCCTCTGAAGA TGG Intergenic
No off target data available for this crispr