ID: 1024678873

View in Genome Browser
Species Human (GRCh38)
Location 7:51662415-51662437
Sequence TGGGAGAAGCAAACTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024678871_1024678873 -8 Left 1024678871 7:51662400-51662422 CCAAGAGCTCAGCAATGGGAGAA No data
Right 1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG No data
1024678868_1024678873 -2 Left 1024678868 7:51662394-51662416 CCAGAGCCAAGAGCTCAGCAATG No data
Right 1024678873 7:51662415-51662437 TGGGAGAAGCAAACTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024678873 Original CRISPR TGGGAGAAGCAAACTGAGCT GGG Intergenic
No off target data available for this crispr