ID: 1024681535

View in Genome Browser
Species Human (GRCh38)
Location 7:51694500-51694522
Sequence CTTGTTTTCAGCATCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024681533_1024681535 28 Left 1024681533 7:51694449-51694471 CCATGTGCAGCAGAAATGCTTCT No data
Right 1024681535 7:51694500-51694522 CTTGTTTTCAGCATCTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024681535 Original CRISPR CTTGTTTTCAGCATCTATAT GGG Intergenic
No off target data available for this crispr