ID: 1024685321

View in Genome Browser
Species Human (GRCh38)
Location 7:51738383-51738405
Sequence GACACTTCTGTCTGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024685321_1024685324 -10 Left 1024685321 7:51738383-51738405 CCTCCTGTGCAGACAGAAGTGTC No data
Right 1024685324 7:51738396-51738418 CAGAAGTGTCCAGGCTATGATGG No data
1024685321_1024685326 12 Left 1024685321 7:51738383-51738405 CCTCCTGTGCAGACAGAAGTGTC No data
Right 1024685326 7:51738418-51738440 GTCATCAGCTATCTATATTCAGG No data
1024685321_1024685329 30 Left 1024685321 7:51738383-51738405 CCTCCTGTGCAGACAGAAGTGTC No data
Right 1024685329 7:51738436-51738458 TCAGGTGTTACCAGAAGGGAAGG No data
1024685321_1024685327 25 Left 1024685321 7:51738383-51738405 CCTCCTGTGCAGACAGAAGTGTC No data
Right 1024685327 7:51738431-51738453 TATATTCAGGTGTTACCAGAAGG No data
1024685321_1024685328 26 Left 1024685321 7:51738383-51738405 CCTCCTGTGCAGACAGAAGTGTC No data
Right 1024685328 7:51738432-51738454 ATATTCAGGTGTTACCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024685321 Original CRISPR GACACTTCTGTCTGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr