ID: 1024685323

View in Genome Browser
Species Human (GRCh38)
Location 7:51738387-51738409
Sequence CTGTGCAGACAGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024685319_1024685323 1 Left 1024685319 7:51738363-51738385 CCTGTGCCGAACATTTATGTCCT No data
Right 1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG No data
1024685320_1024685323 -5 Left 1024685320 7:51738369-51738391 CCGAACATTTATGTCCTCCTGTG No data
Right 1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024685323 Original CRISPR CTGTGCAGACAGAAGTGTCC AGG Intergenic
No off target data available for this crispr