ID: 1024687024

View in Genome Browser
Species Human (GRCh38)
Location 7:51757233-51757255
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024687024_1024687027 14 Left 1024687024 7:51757233-51757255 CCACTTATTTAACAAAATTCCCA No data
Right 1024687027 7:51757270-51757292 TATTAACTTGAGTCCTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024687024 Original CRISPR TGGGAATTTTGTTAAATAAG TGG (reversed) Intergenic
No off target data available for this crispr