ID: 1024688787

View in Genome Browser
Species Human (GRCh38)
Location 7:51777315-51777337
Sequence CAGAGCCAGCACTTCTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024688786_1024688787 -9 Left 1024688786 7:51777301-51777323 CCATGAATAAGTAGCAGAGCCAG No data
Right 1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024688787 Original CRISPR CAGAGCCAGCACTTCTAGCT AGG Intergenic
No off target data available for this crispr