ID: 1024689202

View in Genome Browser
Species Human (GRCh38)
Location 7:51780865-51780887
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024689198_1024689202 10 Left 1024689198 7:51780832-51780854 CCATGATCTGATGGACAGATGGG No data
Right 1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024689202 Original CRISPR CAGCTGTCCCTGAAGACAAA AGG Intergenic
No off target data available for this crispr