ID: 1024689243

View in Genome Browser
Species Human (GRCh38)
Location 7:51781196-51781218
Sequence TCGTATCCTGCAATGCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024689243_1024689246 5 Left 1024689243 7:51781196-51781218 CCACTAAGCATTGCAGGATACGA No data
Right 1024689246 7:51781224-51781246 ACGTTGTTGGTGAAATTTTAAGG No data
1024689243_1024689245 -8 Left 1024689243 7:51781196-51781218 CCACTAAGCATTGCAGGATACGA No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024689243 Original CRISPR TCGTATCCTGCAATGCTTAG TGG (reversed) Intergenic
No off target data available for this crispr