ID: 1024689245

View in Genome Browser
Species Human (GRCh38)
Location 7:51781211-51781233
Sequence GGATACGATGGCAACGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024689243_1024689245 -8 Left 1024689243 7:51781196-51781218 CCACTAAGCATTGCAGGATACGA No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data
1024689241_1024689245 4 Left 1024689241 7:51781184-51781206 CCACACTCGCTGCCACTAAGCAT No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data
1024689239_1024689245 13 Left 1024689239 7:51781175-51781197 CCTGGTTTCCCACACTCGCTGCC No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data
1024689238_1024689245 27 Left 1024689238 7:51781161-51781183 CCACAACTCTGGCTCCTGGTTTC No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data
1024689240_1024689245 5 Left 1024689240 7:51781183-51781205 CCCACACTCGCTGCCACTAAGCA No data
Right 1024689245 7:51781211-51781233 GGATACGATGGCAACGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024689245 Original CRISPR GGATACGATGGCAACGTTGT TGG Intergenic
No off target data available for this crispr