ID: 1024695024

View in Genome Browser
Species Human (GRCh38)
Location 7:51847066-51847088
Sequence ACATGAAGTGTATACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024695024_1024695032 12 Left 1024695024 7:51847066-51847088 CCTTCCCAGTATACACTTCATGT No data
Right 1024695032 7:51847101-51847123 CCCTCTCCAGCTCACTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024695024 Original CRISPR ACATGAAGTGTATACTGGGA AGG (reversed) Intergenic
No off target data available for this crispr