ID: 1024696157

View in Genome Browser
Species Human (GRCh38)
Location 7:51858685-51858707
Sequence TGTCCTCTGCTGATAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024696157_1024696160 -3 Left 1024696157 7:51858685-51858707 CCACCTGTTATCAGCAGAGGACA No data
Right 1024696160 7:51858705-51858727 ACAACACTGGCTGTCTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024696157 Original CRISPR TGTCCTCTGCTGATAACAGG TGG (reversed) Intergenic
No off target data available for this crispr