ID: 1024700099

View in Genome Browser
Species Human (GRCh38)
Location 7:51897599-51897621
Sequence AGAGAGAGCAAAGTAATTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024700099_1024700101 28 Left 1024700099 7:51897599-51897621 CCGACAATTACTTTGCTCTCTCT No data
Right 1024700101 7:51897650-51897672 TGAGAAAAAGTCTTGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024700099 Original CRISPR AGAGAGAGCAAAGTAATTGT CGG (reversed) Intergenic
No off target data available for this crispr