ID: 1024701864

View in Genome Browser
Species Human (GRCh38)
Location 7:51912162-51912184
Sequence ACAGAGAGACAATACGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024701864_1024701866 -5 Left 1024701864 7:51912162-51912184 CCTACACCGTATTGTCTCTCTGT No data
Right 1024701866 7:51912180-51912202 TCTGTTCTGTTAATGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024701864 Original CRISPR ACAGAGAGACAATACGGTGT AGG (reversed) Intergenic
No off target data available for this crispr