ID: 1024702569

View in Genome Browser
Species Human (GRCh38)
Location 7:51920619-51920641
Sequence TACCCACAGCTGATGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024702569_1024702575 8 Left 1024702569 7:51920619-51920641 CCAGTCCCCATCAGCTGTGGGTA No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702569_1024702579 27 Left 1024702569 7:51920619-51920641 CCAGTCCCCATCAGCTGTGGGTA No data
Right 1024702579 7:51920669-51920691 CTGGTGCAGTTGCAGCACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024702569 Original CRISPR TACCCACAGCTGATGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr