ID: 1024702575

View in Genome Browser
Species Human (GRCh38)
Location 7:51920650-51920672
Sequence GTTTTTTATCCCAATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024702565_1024702575 23 Left 1024702565 7:51920604-51920626 CCAGCCAGGATGCTACCAGTCCC No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702569_1024702575 8 Left 1024702569 7:51920619-51920641 CCAGTCCCCATCAGCTGTGGGTA No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702566_1024702575 19 Left 1024702566 7:51920608-51920630 CCAGGATGCTACCAGTCCCCATC No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702564_1024702575 27 Left 1024702564 7:51920600-51920622 CCAACCAGCCAGGATGCTACCAG No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702571_1024702575 2 Left 1024702571 7:51920625-51920647 CCCATCAGCTGTGGGTACAAAGG No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702573_1024702575 1 Left 1024702573 7:51920626-51920648 CCATCAGCTGTGGGTACAAAGGA No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data
1024702570_1024702575 3 Left 1024702570 7:51920624-51920646 CCCCATCAGCTGTGGGTACAAAG No data
Right 1024702575 7:51920650-51920672 GTTTTTTATCCCAATCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024702575 Original CRISPR GTTTTTTATCCCAATCCTGC TGG Intergenic
No off target data available for this crispr