ID: 1024702579

View in Genome Browser
Species Human (GRCh38)
Location 7:51920669-51920691
Sequence CTGGTGCAGTTGCAGCACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024702569_1024702579 27 Left 1024702569 7:51920619-51920641 CCAGTCCCCATCAGCTGTGGGTA No data
Right 1024702579 7:51920669-51920691 CTGGTGCAGTTGCAGCACCACGG No data
1024702571_1024702579 21 Left 1024702571 7:51920625-51920647 CCCATCAGCTGTGGGTACAAAGG No data
Right 1024702579 7:51920669-51920691 CTGGTGCAGTTGCAGCACCACGG No data
1024702570_1024702579 22 Left 1024702570 7:51920624-51920646 CCCCATCAGCTGTGGGTACAAAG No data
Right 1024702579 7:51920669-51920691 CTGGTGCAGTTGCAGCACCACGG No data
1024702573_1024702579 20 Left 1024702573 7:51920626-51920648 CCATCAGCTGTGGGTACAAAGGA No data
Right 1024702579 7:51920669-51920691 CTGGTGCAGTTGCAGCACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024702579 Original CRISPR CTGGTGCAGTTGCAGCACCA CGG Intergenic
No off target data available for this crispr