ID: 1024703745

View in Genome Browser
Species Human (GRCh38)
Location 7:51934591-51934613
Sequence GATTGGTATTTTTAAATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024703741_1024703745 11 Left 1024703741 7:51934557-51934579 CCCCTCTTTAATTTTTTGGGGAT No data
Right 1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG No data
1024703743_1024703745 9 Left 1024703743 7:51934559-51934581 CCTCTTTAATTTTTTGGGGATAG No data
Right 1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG No data
1024703742_1024703745 10 Left 1024703742 7:51934558-51934580 CCCTCTTTAATTTTTTGGGGATA No data
Right 1024703745 7:51934591-51934613 GATTGGTATTTTTAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024703745 Original CRISPR GATTGGTATTTTTAAATGTT TGG Intergenic
No off target data available for this crispr