ID: 1024703970

View in Genome Browser
Species Human (GRCh38)
Location 7:51937999-51938021
Sequence AGCTAGCCCCTGTGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024703970_1024703975 13 Left 1024703970 7:51937999-51938021 CCCTGGGTTCACAGGGGCTAGCT No data
Right 1024703975 7:51938035-51938057 GGCCTTGAACCTGTGTCCTCTGG No data
1024703970_1024703976 14 Left 1024703970 7:51937999-51938021 CCCTGGGTTCACAGGGGCTAGCT No data
Right 1024703976 7:51938036-51938058 GCCTTGAACCTGTGTCCTCTGGG No data
1024703970_1024703974 -8 Left 1024703970 7:51937999-51938021 CCCTGGGTTCACAGGGGCTAGCT No data
Right 1024703974 7:51938014-51938036 GGCTAGCTTGGCATTGGTACTGG No data
1024703970_1024703979 24 Left 1024703970 7:51937999-51938021 CCCTGGGTTCACAGGGGCTAGCT No data
Right 1024703979 7:51938046-51938068 TGTGTCCTCTGGGATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024703970 Original CRISPR AGCTAGCCCCTGTGAACCCA GGG (reversed) Intergenic