ID: 1024703971

View in Genome Browser
Species Human (GRCh38)
Location 7:51938000-51938022
Sequence AAGCTAGCCCCTGTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024703971_1024703979 23 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703979 7:51938046-51938068 TGTGTCCTCTGGGATGAGCCTGG No data
1024703971_1024703976 13 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703976 7:51938036-51938058 GCCTTGAACCTGTGTCCTCTGGG No data
1024703971_1024703974 -9 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703974 7:51938014-51938036 GGCTAGCTTGGCATTGGTACTGG No data
1024703971_1024703975 12 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703975 7:51938035-51938057 GGCCTTGAACCTGTGTCCTCTGG No data
1024703971_1024703981 30 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703981 7:51938053-51938075 TCTGGGATGAGCCTGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024703971 Original CRISPR AAGCTAGCCCCTGTGAACCC AGG (reversed) Intergenic