ID: 1024703975

View in Genome Browser
Species Human (GRCh38)
Location 7:51938035-51938057
Sequence GGCCTTGAACCTGTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024703971_1024703975 12 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703975 7:51938035-51938057 GGCCTTGAACCTGTGTCCTCTGG No data
1024703969_1024703975 14 Left 1024703969 7:51937998-51938020 CCCCTGGGTTCACAGGGGCTAGC No data
Right 1024703975 7:51938035-51938057 GGCCTTGAACCTGTGTCCTCTGG No data
1024703970_1024703975 13 Left 1024703970 7:51937999-51938021 CCCTGGGTTCACAGGGGCTAGCT No data
Right 1024703975 7:51938035-51938057 GGCCTTGAACCTGTGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024703975 Original CRISPR GGCCTTGAACCTGTGTCCTC TGG Intergenic