ID: 1024703981

View in Genome Browser
Species Human (GRCh38)
Location 7:51938053-51938075
Sequence TCTGGGATGAGCCTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024703971_1024703981 30 Left 1024703971 7:51938000-51938022 CCTGGGTTCACAGGGGCTAGCTT No data
Right 1024703981 7:51938053-51938075 TCTGGGATGAGCCTGGATCCTGG No data
1024703977_1024703981 -7 Left 1024703977 7:51938037-51938059 CCTTGAACCTGTGTCCTCTGGGA No data
Right 1024703981 7:51938053-51938075 TCTGGGATGAGCCTGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024703981 Original CRISPR TCTGGGATGAGCCTGGATCC TGG Intergenic