ID: 1024704073

View in Genome Browser
Species Human (GRCh38)
Location 7:51938467-51938489
Sequence CTTTGGAAGACCCAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704073_1024704081 9 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704073_1024704085 24 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704073_1024704078 -7 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704078 7:51938483-51938505 TCCAAAGAATGAGTCCACAGGGG No data
1024704073_1024704076 -9 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704076 7:51938481-51938503 CTTCCAAAGAATGAGTCCACAGG No data
1024704073_1024704083 17 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704073_1024704087 29 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704073_1024704077 -8 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704077 7:51938482-51938504 TTCCAAAGAATGAGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704073 Original CRISPR CTTTGGAAGACCCAGGGTCC AGG (reversed) Intergenic