ID: 1024704074

View in Genome Browser
Species Human (GRCh38)
Location 7:51938473-51938495
Sequence CTCATTCTTTGGAAGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704074_1024704085 18 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704074_1024704083 11 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704074_1024704087 23 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704074_1024704081 3 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704074_1024704089 30 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704089 7:51938526-51938548 CTGGAGACTGGCCTGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704074 Original CRISPR CTCATTCTTTGGAAGACCCA GGG (reversed) Intergenic