ID: 1024704075

View in Genome Browser
Species Human (GRCh38)
Location 7:51938474-51938496
Sequence ACTCATTCTTTGGAAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704075_1024704083 10 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704075_1024704081 2 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704075_1024704090 30 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704075_1024704085 17 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704075_1024704089 29 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704089 7:51938526-51938548 CTGGAGACTGGCCTGGACTCTGG No data
1024704075_1024704087 22 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704075 Original CRISPR ACTCATTCTTTGGAAGACCC AGG (reversed) Intergenic
No off target data available for this crispr