ID: 1024704079

View in Genome Browser
Species Human (GRCh38)
Location 7:51938484-51938506
Sequence GCCCCTGTGGACTCATTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704079_1024704091 27 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704091 7:51938534-51938556 TGGCCTGGACTCTGGGCTCATGG No data
1024704079_1024704087 12 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704079_1024704081 -8 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704079_1024704089 19 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704089 7:51938526-51938548 CTGGAGACTGGCCTGGACTCTGG No data
1024704079_1024704093 30 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704079_1024704090 20 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704079_1024704083 0 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704079_1024704085 7 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704079 Original CRISPR GCCCCTGTGGACTCATTCTT TGG (reversed) Intergenic
No off target data available for this crispr