ID: 1024704081

View in Genome Browser
Species Human (GRCh38)
Location 7:51938499-51938521
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704073_1024704081 9 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704069_1024704081 29 Left 1024704069 7:51938447-51938469 CCTGGGTCTACTGGAAAGGACCT No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704068_1024704081 30 Left 1024704068 7:51938446-51938468 CCCTGGGTCTACTGGAAAGGACC No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704074_1024704081 3 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704075_1024704081 2 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data
1024704079_1024704081 -8 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704081 7:51938499-51938521 ACAGGGGCCAGCCTAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704081 Original CRISPR ACAGGGGCCAGCCTAAATCC TGG Intergenic