ID: 1024704082

View in Genome Browser
Species Human (GRCh38)
Location 7:51938506-51938528
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704082_1024704087 -10 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704082_1024704090 -2 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704082_1024704091 5 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704091 7:51938534-51938556 TGGCCTGGACTCTGGGCTCATGG No data
1024704082_1024704093 8 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704082_1024704089 -3 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704089 7:51938526-51938548 CTGGAGACTGGCCTGGACTCTGG 0: 1
1: 0
2: 3
3: 91
4: 3722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704082 Original CRISPR CAGGACTCCAGGATTTAGGC TGG (reversed) Intergenic