ID: 1024704083

View in Genome Browser
Species Human (GRCh38)
Location 7:51938507-51938529
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704073_1024704083 17 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704075_1024704083 10 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704079_1024704083 0 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data
1024704074_1024704083 11 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704083 7:51938507-51938529 CAGCCTAAATCCTGGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704083 Original CRISPR CAGCCTAAATCCTGGAGTCC TGG Intergenic
No off target data available for this crispr