ID: 1024704084

View in Genome Browser
Species Human (GRCh38)
Location 7:51938510-51938532
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704084_1024704090 -6 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704084_1024704089 -7 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704089 7:51938526-51938548 CTGGAGACTGGCCTGGACTCTGG No data
1024704084_1024704093 4 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704084_1024704095 28 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data
1024704084_1024704091 1 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704091 7:51938534-51938556 TGGCCTGGACTCTGGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704084 Original CRISPR TCTCCAGGACTCCAGGATTT AGG (reversed) Intergenic