ID: 1024704085

View in Genome Browser
Species Human (GRCh38)
Location 7:51938514-51938536
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704074_1024704085 18 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704079_1024704085 7 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704080_1024704085 -6 Left 1024704080 7:51938497-51938519 CCACAGGGGCCAGCCTAAATCCT No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704073_1024704085 24 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data
1024704075_1024704085 17 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704085 Original CRISPR AATCCTGGAGTCCTGGAGAC TGG Intergenic