ID: 1024704086

View in Genome Browser
Species Human (GRCh38)
Location 7:51938517-51938539
Sequence AGGCCAGTCTCCAGGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704086_1024704091 -6 Left 1024704086 7:51938517-51938539 CCTGGAGTCCTGGAGACTGGCCT No data
Right 1024704091 7:51938534-51938556 TGGCCTGGACTCTGGGCTCATGG No data
1024704086_1024704093 -3 Left 1024704086 7:51938517-51938539 CCTGGAGTCCTGGAGACTGGCCT No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704086_1024704095 21 Left 1024704086 7:51938517-51938539 CCTGGAGTCCTGGAGACTGGCCT No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG 0: 1
1: 0
2: 1
3: 33
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704086 Original CRISPR AGGCCAGTCTCCAGGACTCC AGG (reversed) Intergenic