ID: 1024704087

View in Genome Browser
Species Human (GRCh38)
Location 7:51938519-51938541
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704080_1024704087 -1 Left 1024704080 7:51938497-51938519 CCACAGGGGCCAGCCTAAATCCT No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704079_1024704087 12 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704075_1024704087 22 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704074_1024704087 23 Left 1024704074 7:51938473-51938495 CCCTGGGTCTTCCAAAGAATGAG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704082_1024704087 -10 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data
1024704073_1024704087 29 Left 1024704073 7:51938467-51938489 CCTGGACCCTGGGTCTTCCAAAG No data
Right 1024704087 7:51938519-51938541 TGGAGTCCTGGAGACTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704087 Original CRISPR TGGAGTCCTGGAGACTGGCC TGG Intergenic