ID: 1024704088

View in Genome Browser
Species Human (GRCh38)
Location 7:51938525-51938547
Sequence CAGAGTCCAGGCCAGTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704088_1024704095 13 Left 1024704088 7:51938525-51938547 CCTGGAGACTGGCCTGGACTCTG No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704088 Original CRISPR CAGAGTCCAGGCCAGTCTCC AGG (reversed) Intergenic