ID: 1024704090

View in Genome Browser
Species Human (GRCh38)
Location 7:51938527-51938549
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704084_1024704090 -6 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704080_1024704090 7 Left 1024704080 7:51938497-51938519 CCACAGGGGCCAGCCTAAATCCT No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704079_1024704090 20 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704075_1024704090 30 Left 1024704075 7:51938474-51938496 CCTGGGTCTTCCAAAGAATGAGT No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data
1024704082_1024704090 -2 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704090 7:51938527-51938549 TGGAGACTGGCCTGGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704090 Original CRISPR TGGAGACTGGCCTGGACTCT GGG Intergenic