ID: 1024704092

View in Genome Browser
Species Human (GRCh38)
Location 7:51938537-51938559
Sequence CCTCCATGAGCCCAGAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704092_1024704095 1 Left 1024704092 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data
1024704092_1024704096 21 Left 1024704092 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
Right 1024704096 7:51938581-51938603 TGGATGCTACCCTAGAAGCTAGG No data
1024704092_1024704098 30 Left 1024704092 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
Right 1024704098 7:51938590-51938612 CCCTAGAAGCTAGGTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704092 Original CRISPR CCTCCATGAGCCCAGAGTCC AGG (reversed) Intergenic