ID: 1024704093

View in Genome Browser
Species Human (GRCh38)
Location 7:51938537-51938559
Sequence CCTGGACTCTGGGCTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704084_1024704093 4 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704086_1024704093 -3 Left 1024704086 7:51938517-51938539 CCTGGAGTCCTGGAGACTGGCCT No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704080_1024704093 17 Left 1024704080 7:51938497-51938519 CCACAGGGGCCAGCCTAAATCCT No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704079_1024704093 30 Left 1024704079 7:51938484-51938506 CCAAAGAATGAGTCCACAGGGGC No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
1024704082_1024704093 8 Left 1024704082 7:51938506-51938528 CCAGCCTAAATCCTGGAGTCCTG No data
Right 1024704093 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704093 Original CRISPR CCTGGACTCTGGGCTCATGG AGG Intergenic