ID: 1024704095

View in Genome Browser
Species Human (GRCh38)
Location 7:51938561-51938583
Sequence CAGCTTGAAAACAAAATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704084_1024704095 28 Left 1024704084 7:51938510-51938532 CCTAAATCCTGGAGTCCTGGAGA No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data
1024704092_1024704095 1 Left 1024704092 7:51938537-51938559 CCTGGACTCTGGGCTCATGGAGG No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data
1024704088_1024704095 13 Left 1024704088 7:51938525-51938547 CCTGGAGACTGGCCTGGACTCTG No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data
1024704086_1024704095 21 Left 1024704086 7:51938517-51938539 CCTGGAGTCCTGGAGACTGGCCT No data
Right 1024704095 7:51938561-51938583 CAGCTTGAAAACAAAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704095 Original CRISPR CAGCTTGAAAACAAAATGTG TGG Intergenic