ID: 1024704107

View in Genome Browser
Species Human (GRCh38)
Location 7:51938625-51938647
Sequence GGAGAAGCCCCTGAAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704107_1024704110 -3 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704110 7:51938645-51938667 TCCTGGAAGCTGAAGATGTAGGG No data
1024704107_1024704113 23 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704113 7:51938671-51938693 ATTTTGACACCATGTGGATCTGG No data
1024704107_1024704114 30 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG No data
1024704107_1024704109 -4 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704109 7:51938644-51938666 CTCCTGGAAGCTGAAGATGTAGG No data
1024704107_1024704112 17 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704112 7:51938665-51938687 GGGATTATTTTGACACCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704107 Original CRISPR GGAGAAGCCCCTGAAGTCCC AGG (reversed) Intergenic
No off target data available for this crispr