ID: 1024704111

View in Genome Browser
Species Human (GRCh38)
Location 7:51938646-51938668
Sequence TCCCTACATCTTCAGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704111_1024704114 9 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG No data
1024704111_1024704115 10 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704115 7:51938679-51938701 ACCATGTGGATCTGGAGCCTGGG No data
1024704111_1024704113 2 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704113 7:51938671-51938693 ATTTTGACACCATGTGGATCTGG No data
1024704111_1024704117 18 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704117 7:51938687-51938709 GATCTGGAGCCTGGGTCTGCAGG No data
1024704111_1024704112 -4 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704112 7:51938665-51938687 GGGATTATTTTGACACCATGTGG No data
1024704111_1024704119 30 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704119 7:51938699-51938721 GGGTCTGCAGGTGCTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704111 Original CRISPR TCCCTACATCTTCAGCTTCC AGG (reversed) Intergenic
No off target data available for this crispr