ID: 1024704114

View in Genome Browser
Species Human (GRCh38)
Location 7:51938678-51938700
Sequence CACCATGTGGATCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024704111_1024704114 9 Left 1024704111 7:51938646-51938668 CCTGGAAGCTGAAGATGTAGGGA No data
Right 1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG No data
1024704107_1024704114 30 Left 1024704107 7:51938625-51938647 CCTGGGACTTCAGGGGCTTCTCC No data
Right 1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024704114 Original CRISPR CACCATGTGGATCTGGAGCC TGG Intergenic
No off target data available for this crispr