ID: 1024705957

View in Genome Browser
Species Human (GRCh38)
Location 7:51959786-51959808
Sequence GAGGAAGAATGCAGTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705957_1024705964 13 Left 1024705957 7:51959786-51959808 CCCCAGTCACTGCATTCTTCCTC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705957_1024705966 26 Left 1024705957 7:51959786-51959808 CCCCAGTCACTGCATTCTTCCTC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705957_1024705967 30 Left 1024705957 7:51959786-51959808 CCCCAGTCACTGCATTCTTCCTC No data
Right 1024705967 7:51959839-51959861 GCGAGGCTCTTGCCAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705957 Original CRISPR GAGGAAGAATGCAGTGACTG GGG (reversed) Intergenic
No off target data available for this crispr