ID: 1024705958

View in Genome Browser
Species Human (GRCh38)
Location 7:51959787-51959809
Sequence GGAGGAAGAATGCAGTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705958_1024705968 30 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705958_1024705967 29 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705967 7:51959839-51959861 GCGAGGCTCTTGCCAGAGGTTGG No data
1024705958_1024705966 25 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705958_1024705964 12 Left 1024705958 7:51959787-51959809 CCCAGTCACTGCATTCTTCCTCC No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705958 Original CRISPR GGAGGAAGAATGCAGTGACT GGG (reversed) Intergenic
No off target data available for this crispr