ID: 1024705960

View in Genome Browser
Species Human (GRCh38)
Location 7:51959805-51959827
Sequence AGAATCTGTGCACTTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 13, 1: 38, 2: 125, 3: 202, 4: 596}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705960_1024705966 7 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705960_1024705970 22 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705970 7:51959850-51959872 GCCAGAGGTTGGGGCAGAAGTGG No data
1024705960_1024705967 11 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705967 7:51959839-51959861 GCGAGGCTCTTGCCAGAGGTTGG No data
1024705960_1024705968 12 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705960_1024705964 -6 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data
1024705960_1024705969 13 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT 0: 13
1: 38
2: 125
3: 202
4: 596
Right 1024705969 7:51959841-51959863 GAGGCTCTTGCCAGAGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705960 Original CRISPR AGAATCTGTGCACTTTGGGG AGG (reversed) Intergenic
900465007 1:2821291-2821313 AGAGTCTGTGAGCTTGGGGGTGG + Intergenic
902357595 1:15916869-15916891 ATAATCTCAGCACTTTGGGAGGG + Intronic
903594632 1:24484676-24484698 ATAATCCCAGCACTTTGGGGAGG + Intergenic
903814900 1:26057781-26057803 AGATTCTGCTCAGTTTGGGGTGG - Intronic
905163075 1:36054091-36054113 ATAGTCTCAGCACTTTGGGGAGG - Intronic
908397696 1:63741232-63741254 AGAATCTGTGCACTTGAGGGAGG - Intergenic
909209815 1:72808773-72808795 AGAAGCTGTGTACTTGGGGAAGG - Intergenic
909438516 1:75672274-75672296 AAAATCTGTGTACTTTGGGGAGG + Intergenic
910202539 1:84714160-84714182 AGAATGTGGACATTTTGGGGAGG + Intergenic
910289653 1:85588028-85588050 AGAATCTGTGCTCTTGGGAGAGG + Intergenic
910330544 1:86068336-86068358 AGAATCTGTGCACTCTAGGAAGG + Intronic
910349427 1:86278330-86278352 TGAATCTGTGTACTTTGGAGAGG - Intergenic
910384224 1:86664330-86664352 AGAATCTGTGTGCTTAAGGGAGG + Intergenic
910384431 1:86665590-86665612 AGAATCTGTGTGCTTAAGGGAGG - Intergenic
910627399 1:89322717-89322739 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
911241474 1:95471741-95471763 ACAATCTGTGCACTTGGGGGAGG - Intergenic
911487057 1:98515579-98515601 AGAATCTATACACTTGGGAGGGG + Intergenic
911960842 1:104300895-104300917 ACAATCTGGGCATTTCGGGGAGG + Intergenic
912116863 1:106418136-106418158 AGAATCTGTGCACTTAGGATAGG + Intergenic
912152640 1:106879423-106879445 AGAGTCTGTGTACTTGAGGGAGG + Intergenic
912154350 1:106898960-106898982 AGAAACTGTACAATTTGGGCTGG - Intergenic
912316306 1:108670234-108670256 AGAGTCTATGCACTTGGGGGTGG + Intergenic
912516382 1:110219039-110219061 AGAATCCATGCCCTTTGTGGTGG + Intronic
912840085 1:113031744-113031766 ATAATCTCAGCACTTTGGGAAGG + Intergenic
912871402 1:113310460-113310482 AAAATCTGGGTACTTGGGGGAGG + Intergenic
913199509 1:116484472-116484494 ATAATCCTAGCACTTTGGGGAGG + Intergenic
914919830 1:151839278-151839300 AGAATCTGTGTACTTGGTGACGG - Intronic
915119594 1:153620807-153620829 GCAATCTCAGCACTTTGGGGAGG + Intronic
915587209 1:156850466-156850488 GTAATCTCTGCACTTTGGGAGGG - Intronic
915777602 1:158507457-158507479 AGAATCTGTGTGCTTGGGGAAGG - Intergenic
915976351 1:160392680-160392702 ATAATCTCAGCACTTTTGGGAGG - Intergenic
916341945 1:163745964-163745986 AGAATCTGTGCCCTTGAGGGAGG - Intergenic
916358743 1:163943440-163943462 ATAATCTCAGCACTTTGGGAGGG + Intergenic
916475466 1:165164501-165164523 ACCTTCTGTGCACTTTGGAGAGG + Intergenic
917024924 1:170631427-170631449 AGAATCTGTGCATTCTGGGGTGG + Intergenic
917153253 1:171966731-171966753 ACACTATGTTCACTTTGGGGTGG + Intronic
917246359 1:173005170-173005192 ATAATCTCTGCATTTTGGGGAGG - Intergenic
917300680 1:173570852-173570874 AGAATCTGTGCACTTGGGGAAGG - Intronic
917986750 1:180327342-180327364 AGAATCTGTGCACTTGGAGAGGG - Intronic
918018961 1:180665677-180665699 AGAATCTCTGCACTTGAGGGAGG - Intronic
918357889 1:183723485-183723507 AGAATCTGTGCTCTTGCGGGAGG + Intronic
918476322 1:184928648-184928670 AGAATCTGTATGCTTGGGGGAGG - Intronic
918752691 1:188292519-188292541 AAAAACTGTGCACTTGGGAGAGG + Intergenic
919147339 1:193651955-193651977 AGAATCTGTGCATTTGGAGAAGG - Intergenic
919169701 1:193938532-193938554 AGAATCTGTGCACTTGGGGAGGG + Intergenic
919257596 1:195143420-195143442 AGAATCTGTGCAGTTTGTGGGGG - Intergenic
920595052 1:207260318-207260340 AGAATCTGTGTGCTTGGGAGAGG - Intergenic
921146942 1:212367344-212367366 AGAATCTGTGAGCTTGGGAGAGG + Intronic
921929505 1:220743576-220743598 AGAGTCTGTGCTCTTGGGGGAGG - Intergenic
922377029 1:224979306-224979328 ATAATCTGAGCACTTAGAGGAGG + Intronic
923030680 1:230246981-230247003 ATAATCCCAGCACTTTGGGGAGG + Intronic
923868867 1:237969545-237969567 AAAGTGTGTGTACTTTGGGGTGG + Intergenic
924020584 1:239777455-239777477 GGAAGCTGTGCTATTTGGGGTGG + Intronic
924262839 1:242249647-242249669 AGAATATGTGCAGTTTGCTGAGG - Intronic
924516325 1:244769031-244769053 AGAACCTGTGTGCTTGGGGGAGG - Intergenic
1062788223 10:282962-282984 AGACTCTGAGCACTTTGCTGTGG + Intronic
1062871251 10:906923-906945 AGAATCTGTGGAGTTTGGGGAGG - Intronic
1063440183 10:6066677-6066699 AGAATTTGTGAGCTTTGGCGAGG + Intergenic
1064446463 10:15398328-15398350 AGAATCTGTGTACTTTGGGGAGG + Intergenic
1064521791 10:16210315-16210337 AGAATCTGTGCTCTTGGGAGAGG - Intergenic
1065274969 10:24076537-24076559 AGAATCTGTGCACATGGAAGTGG - Intronic
1065381960 10:25099896-25099918 ATAATCTCAGCACTTTTGGGAGG + Intergenic
1065460269 10:25954927-25954949 AGAATCTGACCACATTAGGGTGG - Exonic
1065584442 10:27203891-27203913 ATAATCCCAGCACTTTGGGGAGG - Intronic
1065921713 10:30398939-30398961 AGAATCTGTGCACTTGGGGAAGG + Intergenic
1066143110 10:32527234-32527256 AGAATCTGTGCACTTTGGGGAGG - Intronic
1066345177 10:34578129-34578151 CTAATCTCAGCACTTTGGGGAGG - Intronic
1067324396 10:45253310-45253332 AGAATCTGTGTGCTTTGGAGAGG + Intergenic
1068226064 10:54108308-54108330 AGGATCTGTGCACTTGAGAGAGG + Intronic
1068699684 10:60006732-60006754 GGAATCTTGGCATTTTGGGGAGG + Intergenic
1069032228 10:63609502-63609524 AAAATCTCAGCACTTTGGGAAGG + Intronic
1069056154 10:63847096-63847118 AGAATCTGTGCATTTGGGAGAGG + Intergenic
1069193573 10:65520322-65520344 AGAATCTGTGCACTTGAGGGAGG - Intergenic
1069256870 10:66343969-66343991 GTAATCTGAGCACTTTGGGAGGG + Intronic
1069343315 10:67438721-67438743 AGAATCTGTGCACAAGGGGGTGG + Intronic
1070089687 10:73272089-73272111 GTAATCCCTGCACTTTGGGGTGG + Intronic
1071156542 10:82696058-82696080 AGAATGTGTGCACTTAGGAGAGG - Intronic
1071629674 10:87208277-87208299 AGAATCGCTGGACCTTGGGGAGG - Intergenic
1072454872 10:95567051-95567073 ATAATCTCAGCACTTTGGGAGGG + Intergenic
1072492505 10:95921337-95921359 AGAATCTGTGCACTTGGAGGAGG - Intronic
1072769608 10:98126490-98126512 AGACTCGGTGCTGTTTGGGGAGG - Intergenic
1072813357 10:98481063-98481085 AGACTGTGTGCACTGTGTGGAGG - Intronic
1072853761 10:98925042-98925064 AGAACTTGAGCACTTTGGGGAGG - Intronic
1072967731 10:99988916-99988938 ATAATCTCAGCACTTTTGGGAGG - Intronic
1072999586 10:100276882-100276904 GCAATCTCCGCACTTTGGGGGGG - Intronic
1073827217 10:107337498-107337520 AGAATCTGTGCACTTGGAGGAGG - Intergenic
1073872311 10:107879635-107879657 AGAATCTGTGCACTTGGGGGAGG + Intergenic
1074038312 10:109762772-109762794 ATAATCTGTGCTCTTGGGAGAGG - Intergenic
1074408258 10:113200045-113200067 AGAATCAGTGAACTTTGAGATGG + Intergenic
1074436656 10:113440162-113440184 AGAGTCAGTGCAGTTGGGGGAGG - Intergenic
1075204619 10:120436305-120436327 AGTATCTGTGCCCTTTAAGGTGG + Intergenic
1075646936 10:124102837-124102859 AGACCCTGTGCTCTTTGAGGGGG - Intergenic
1075681583 10:124337158-124337180 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1075695328 10:124430464-124430486 ATAATCTCAGCACTTTGGGGAGG - Intergenic
1077427327 11:2489222-2489244 AGAATCTGAGAGCTTGGGGGAGG + Intronic
1077435677 11:2537970-2537992 ATAATCTCAGCACTTTGGGTTGG - Intronic
1077835369 11:5922645-5922667 AGAATCTGTTAACTTTGGGGAGG + Intronic
1077858763 11:6156784-6156806 AGAATCTGTGCACTTGTGGGAGG + Intergenic
1078244721 11:9563638-9563660 AGAATCTGTGTGCTTCAGGGAGG - Intergenic
1078690778 11:13578715-13578737 AGAATCTGTGCACTTGGGTGAGG + Intergenic
1078843197 11:15097746-15097768 AGAATCTGTGCTCTTGGGAGAGG - Intergenic
1079069380 11:17329608-17329630 AGAGTCTGTGCCCTCTGGGGAGG - Intronic
1079444724 11:20548126-20548148 GCAATCTCGGCACTTTGGGGGGG - Intergenic
1079516903 11:21280507-21280529 AGAATCTGTGCATTTGTGGGAGG + Intronic
1079723301 11:23846605-23846627 AGAATCTGTCTGCTTGGGGGAGG - Intergenic
1080128464 11:28765891-28765913 AGATTCTGTGCATTTGGGAGAGG + Intergenic
1080588030 11:33699054-33699076 GTAATCTCAGCACTTTGGGGGGG - Intronic
1080707256 11:34707961-34707983 ACAATCTGTGCACTTGAGGCAGG - Intergenic
1081320497 11:41686500-41686522 AGAATCTAAGCAGTTTGGGAGGG + Intergenic
1083037740 11:59655969-59655991 AGAAGCTGTGCTCTCTGGAGGGG + Exonic
1083512889 11:63227955-63227977 AGAATCTGTGCACTTGGGGGAGG - Intronic
1083538976 11:63498484-63498506 AGAATCTGTGCACTCTGGGGAGG - Intergenic
1084054246 11:66621631-66621653 ATAATCCCAGCACTTTGGGGAGG - Intronic
1084137700 11:67199033-67199055 GTAATCTCAGCACTTTGGGGAGG - Intronic
1084763962 11:71295421-71295443 AGAATCTGTGCACTCTGGGGAGG - Intergenic
1085080117 11:73627011-73627033 ATAATCTCAGCACTTTGGGGAGG + Intergenic
1085147198 11:74212176-74212198 AGAATCTGTGTGCTTGTGGGAGG + Intronic
1085194854 11:74662977-74662999 AGAATCTGTGTGGTTGGGGGAGG - Intronic
1085372406 11:76021042-76021064 AGCATCTGTGCTCTTGAGGGAGG - Intronic
1085572247 11:77569551-77569573 AGAGTCTGTGCACTTGTGGGAGG - Intronic
1085686911 11:78631737-78631759 AGAATCTGTGTGCTTAGGGAAGG - Intergenic
1086032987 11:82383193-82383215 AGAATCTGTGCACTTGAAGGAGG + Intergenic
1086249839 11:84799347-84799369 AGAATCTGTGCACTTGGGGGAGG - Intronic
1086261622 11:84947039-84947061 AGAATCTGTGTGCTTGGGAGAGG - Intronic
1087012991 11:93530790-93530812 GGAATGTGTGCACTTGGGGCTGG - Intronic
1087370590 11:97279229-97279251 ATAATGTTTGCACTTTGAGGAGG + Intergenic
1087721081 11:101665895-101665917 AGAGTCTGTGCACTTGGGAAAGG - Intronic
1087871312 11:103296031-103296053 AGAATCTGTGTGCGTAGGGGAGG - Intronic
1088274050 11:108065622-108065644 AGAATCTGTGTGCTTGGGAGAGG - Intronic
1088585758 11:111358968-111358990 AGGAAATGAGCACTTTGGGGTGG - Intronic
1088944584 11:114496332-114496354 AAAATCTGTGCACTTGGGAAGGG - Intergenic
1089254984 11:117189445-117189467 GGAGGCTCTGCACTTTGGGGCGG - Intronic
1089616698 11:119698903-119698925 AGCAGCTGTGGCCTTTGGGGAGG - Intronic
1089864856 11:121622845-121622867 AGAATCTGTCCACCCTTGGGTGG - Intronic
1090065317 11:123498367-123498389 AGAATCTGTACACTTGGGAGAGG - Intergenic
1090065585 11:123500586-123500608 AGTGTCTGTGTACTTTGTGGAGG + Intergenic
1090111099 11:123910467-123910489 AGAATCTGTGCACTTTGGGGAGG + Intergenic
1090210495 11:124917586-124917608 AGAATCTCTGCACTTGCGGGAGG - Intergenic
1090217318 11:124981240-124981262 ATATTCTGTTAACTTTGGGGTGG + Intronic
1090221052 11:125026373-125026395 AGAATCAAGGCACTTAGGGGAGG - Intronic
1091141286 11:133237255-133237277 AGAATTTGTACACCCTGGGGTGG + Intronic
1091275967 11:134350445-134350467 AGGATCTGTGCATTTGGGGAAGG - Intronic
1092084947 12:5749179-5749201 AGAAACTGTGCATTTTAGGAAGG - Intronic
1092670755 12:10858299-10858321 AGAATCTGTAGACTTGGGGAGGG + Intronic
1092887051 12:12934036-12934058 ATCCCCTGTGCACTTTGGGGTGG + Intergenic
1093028380 12:14265559-14265581 ATAATCTCAGCACTTTGGGAGGG - Intergenic
1093479781 12:19592756-19592778 ATAATCTCAGCACTTTGGGAGGG + Intronic
1093581735 12:20791214-20791236 AGAATCTGTGCACTGTGGGGAGG - Intergenic
1093619888 12:21276718-21276740 GGAATCTGAGCACTTGGGAGAGG + Intronic
1093694383 12:22143707-22143729 AGAATCTGTGCACTTGAGGGAGG + Intronic
1094133862 12:27103292-27103314 AGAGTCTGTGCACTTTCAGGAGG + Intergenic
1094183948 12:27621074-27621096 AGAGTCTGTGCACTTTCAGGAGG + Intronic
1094525952 12:31231178-31231200 AAAATCTGTGCACATTTGGAAGG + Intergenic
1095163211 12:38941068-38941090 AGAATCTGTACACTTTGGGGAGG + Intergenic
1095172943 12:39056577-39056599 AGCTTCTGTAGACTTTGGGGAGG + Intergenic
1095181826 12:39154825-39154847 AGAATCTGTGCACTTGGGGGAGG - Intergenic
1095624997 12:44304171-44304193 AGAATCTATGTGCTTAGGGGAGG + Intronic
1095860138 12:46907782-46907804 AGAATCTGTGCACTTGGGGAAGG + Intergenic
1096315081 12:50557412-50557434 ATGATCTCTCCACTTTGGGGCGG + Intronic
1097508512 12:60506913-60506935 AAAGTCTGTGCACTTGGGGGAGG + Intergenic
1097899390 12:64857919-64857941 AGAGTCTGTGCACTTGGGGATGG - Intronic
1098046593 12:66407520-66407542 AAAAACTGTGCACTTGTGGGAGG + Intronic
1098395199 12:70010193-70010215 ACAATCTGTGCACTTGGGGGAGG + Intergenic
1098503841 12:71226544-71226566 AGAATCTGTGCACTTGGGGGAGG + Intronic
1098736732 12:74113871-74113893 ATAATCTGTACACTTGGTGGAGG - Intergenic
1099021978 12:77417415-77417437 AGAAAATGTGGATTTTGGGGTGG - Intergenic
1099101014 12:78440114-78440136 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
1099616025 12:84937521-84937543 AAAATCCATGCACTTTGGGGAGG + Intergenic
1099764269 12:86961647-86961669 AGAGCCTGTGCACTTGAGGGAGG - Intergenic
1099807830 12:87542792-87542814 GGAATCAGTGCACTTGGGGAAGG + Intergenic
1099826230 12:87780571-87780593 AGAATCTGTGCATTTTGGGGAGG - Intergenic
1100487517 12:95044627-95044649 ATAATCCCAGCACTTTGGGGGGG + Intronic
1100487561 12:95044942-95044964 ATAATCTCAGCACTTTTGGGAGG + Intronic
1100904806 12:99285736-99285758 AGAATCTGTGTGCTTGGGGGAGG + Intronic
1100946298 12:99787799-99787821 AAAATCTGTGCATTTTAGGAAGG + Intronic
1101484351 12:105137275-105137297 AGAATCTGTTCTCATTGGGCTGG + Intronic
1101607369 12:106257873-106257895 AGAATCTGTGCACTTGAGGGAGG + Intronic
1102265487 12:111481052-111481074 AAAATCTCAGCACTTTGGGAAGG + Intronic
1102685826 12:114723765-114723787 ATAATCTGAGCACTTTAGGGGGG + Intergenic
1103035668 12:117654461-117654483 TGCAGCTGTGCACTTTCGGGTGG - Intronic
1103232038 12:119339527-119339549 ATAATCTGAACACTTTGGGGGGG + Intronic
1103396582 12:120611836-120611858 TGCAGCTGTCCACTTTGGGGTGG - Intergenic
1103461187 12:121106458-121106480 AGAATCAGTGTGCTTTGGAGAGG + Intergenic
1103494568 12:121351710-121351732 ATAATCTCCGCACTTTGGGAGGG - Intronic
1103641094 12:122353086-122353108 TGCATCTTTGCACTTTGGGAGGG + Intronic
1104661609 12:130615565-130615587 ATAATCCCAGCACTTTGGGGAGG - Intronic
1104861521 12:131926680-131926702 GCAATCTCAGCACTTTGGGGGGG + Intergenic
1105951812 13:25235745-25235767 AGCATCTGTGAACTTTGGACAGG - Intergenic
1107177990 13:37422409-37422431 AGAATCTGTGCACTTGGAGGAGG + Intergenic
1107210753 13:37851809-37851831 AAAGTCTGTGCACTTGGAGGAGG + Intronic
1107421471 13:40251289-40251311 AGACTCTGTGAACTGTTGGGAGG + Intergenic
1107448072 13:40485745-40485767 CGCATCTGTGCACTCTGAGGTGG - Intergenic
1107539070 13:41368943-41368965 AGTATCAGTGGACTTTGTGGGGG + Intronic
1107575901 13:41721889-41721911 AGACTCAGTGCTTTTTGGGGAGG - Intronic
1107774540 13:43823764-43823786 AGAATCTGTGCACTTGAGGGAGG - Intergenic
1108857932 13:54819252-54819274 AGAATCTGTGTACTTGGTGAAGG + Intergenic
1108889904 13:55244560-55244582 AGAATCTGTGCCTTTAGGAGAGG + Intergenic
1108997134 13:56748244-56748266 ATAATCTATGCACTTGGGGAAGG - Intergenic
1109211367 13:59538982-59539004 AGAGTCTATGCACTTGGGGGAGG - Intergenic
1109336782 13:61004293-61004315 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
1109693173 13:65919666-65919688 AGAATCTCTTGAGTTTGGGGGGG + Intergenic
1109747531 13:66646878-66646900 AGTATCTGTACACTTGAGGGAGG + Intronic
1109824205 13:67696911-67696933 AGAATCTATGCACTTGGAAGAGG + Intergenic
1109961763 13:69640044-69640066 AGAATCTGTGCATCTGAGGGAGG - Intergenic
1110665877 13:78116790-78116812 AGAATGTGTGCACTTGAGGGAGG - Intergenic
1111300470 13:86342617-86342639 AGAATCTGTGCCCTTGGTTGAGG - Intergenic
1111639190 13:90946605-90946627 GGAATCTGTGTGCTTGGGGGAGG + Intergenic
1112186218 13:97130329-97130351 TGGATATGGGCACTTTGGGGTGG - Intergenic
1112871537 13:103977081-103977103 AGATTTTCTGCACTCTGGGGAGG + Intergenic
1112944504 13:104910768-104910790 AGAATCTGTGCACTTGGGGGAGG - Intergenic
1113021925 13:105896661-105896683 AGAATCTCTGCACTTGGCAGAGG - Intergenic
1113174397 13:107545723-107545745 AGAATGTGGGCAGTGTGGGGTGG + Intronic
1113213020 13:108004068-108004090 AGAATCTGTACACTTGGGAGAGG - Intergenic
1113558491 13:111257757-111257779 AAAACCTGTGCACTTCGGAGAGG + Intronic
1114761702 14:25322991-25323013 AGAATTTGTGCTCTTGGGAGAGG - Intergenic
1114898555 14:27026238-27026260 AGAATCTGTGAGCTTCCGGGAGG - Intergenic
1114968828 14:28000861-28000883 AAAATCTGTGCTCTTGGGAGGGG + Intergenic
1115244246 14:31278753-31278775 GTAATCTCAGCACTTTGGGGAGG - Intergenic
1115282504 14:31679114-31679136 AGAATCTGTGTGCTTGGGGAGGG - Intronic
1115821605 14:37218678-37218700 AGAATCTTAGCACTTTTGAGAGG + Intronic
1116085862 14:40237001-40237023 TGAGTCTGTGCACTTTGGGAAGG - Intergenic
1116257009 14:42570153-42570175 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
1116392725 14:44413023-44413045 ATAAACTGTGCACTTAGGGAAGG + Intergenic
1116573103 14:46543798-46543820 ATCATCTGTGCATTTTTGGGAGG + Intergenic
1117384371 14:55195829-55195851 AGAATCTGTGCACTTTGGGGAGG - Intergenic
1117504548 14:56389128-56389150 AAAATCTGTGCACTTGGGGAGGG - Intergenic
1117634755 14:57730033-57730055 ACCATCTGTGCCCTATGGGGAGG - Intronic
1117870653 14:60197432-60197454 AGAATCTGTGCATTTGGGGGAGG + Intergenic
1118034285 14:61849643-61849665 AGAATCTGTGCACTTGAGGGAGG - Intergenic
1118241282 14:64060949-64060971 AGAATCCGTGCACGTGGGGGAGG - Intronic
1118431289 14:65720969-65720991 AGAATCTGTGTGCTTGGGGGAGG - Intronic
1118543429 14:66857839-66857861 AGAATCTGTGCATTTGGGAGAGG + Intronic
1118962285 14:70545321-70545343 AGAATCTGCGCACTTGGGAGAGG + Intergenic
1119083873 14:71722080-71722102 AGAATCTGTGCACGTCAGAGAGG - Intronic
1119344017 14:73906732-73906754 ATAATCTCAGCACTTTGGGAGGG - Intronic
1120100003 14:80434454-80434476 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
1120275594 14:82369583-82369605 AGAATCTGTGCACTTGTGGGAGG + Intergenic
1120467846 14:84884520-84884542 AGAATCTGTGTGCTTGGGGAAGG + Intergenic
1120924028 14:89780250-89780272 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1121375825 14:93410133-93410155 AGAATCTGGACACTTGGGAGTGG + Intronic
1121564609 14:94899608-94899630 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1121771998 14:96553766-96553788 GGAATCCTGGCACTTTGGGGAGG - Intronic
1123502463 15:20902445-20902467 AGAATCTGTACACTTGGGAGAGG + Intergenic
1123559713 15:21476112-21476134 AGAATCTGTACACTTGGGAGAGG + Intergenic
1123595947 15:21913411-21913433 AGAATCTGTACACTTGGGAGAGG + Intergenic
1124401202 15:29349106-29349128 ACAGTCTGTGAACTTTCGGGGGG - Intronic
1124720135 15:32104558-32104580 AGAATGTGTGCACAGTGTGGGGG + Intronic
1125277117 15:38004709-38004731 AGAATCTGTGCACTTTGGGGAGG - Intergenic
1125639971 15:41222369-41222391 ATAATCTCAGCACTTTGGGAGGG - Intronic
1125728086 15:41878303-41878325 AGAAGGGGTGCACTTTGGGCTGG - Intronic
1125821502 15:42636038-42636060 ATAATCTCAACACTTTGGGGTGG + Intronic
1126246869 15:46517787-46517809 AGAATCTGTGTGATTTGGAGAGG + Intergenic
1127120676 15:55769153-55769175 GAAATCTCAGCACTTTGGGGAGG + Intergenic
1127132523 15:55882344-55882366 AGAATCCGTGCACTTAGGGTTGG + Intronic
1127178144 15:56383220-56383242 AGAGTCTGTGCACTTAGGGGAGG - Intronic
1127493200 15:59484538-59484560 AGAATCTGTGTGCTTTGAGGAGG + Intronic
1127904445 15:63365881-63365903 ATAATCTCAGCACTTTGGGAGGG + Intronic
1127971650 15:63966753-63966775 AGAACCTGTGCACTTGGGGGAGG - Intronic
1128372026 15:67047422-67047444 AGAAACTCTGCACTTGGAGGGGG + Intergenic
1129030755 15:72616037-72616059 AGAATCTGTGCACCTGGGGGAGG - Intergenic
1129349534 15:74947104-74947126 AAAATCTCAGAACTTTGGGGAGG - Intergenic
1129477598 15:75796561-75796583 AGAATCTGTGCACCTGGGGGAGG - Intergenic
1129835665 15:78703838-78703860 AGAATCTGTGCACCTGGGGGAGG - Intronic
1130400471 15:83547394-83547416 AGAATCTGTGCACTTGCGGGAGG - Intronic
1130441264 15:83956237-83956259 AGAATCTGTGCACTTCAGGGAGG - Intronic
1130511671 15:84594798-84594820 AGAATCTGTGCACTTGGGAGAGG + Intergenic
1131059330 15:89394980-89395002 AGAAGCTTTGCACTCTGGGGAGG - Intergenic
1131315240 15:91329782-91329804 AGAATCTGTGTACTTTGGAGAGG - Intergenic
1131535662 15:93235510-93235532 GTAATCTCTGCACTTTGGGAGGG + Intergenic
1202968055 15_KI270727v1_random:203274-203296 AGAATCTGTACACTTGGGAGAGG + Intergenic
1132773578 16:1578966-1578988 GTAATCTGAGCACTTTGGGGAGG - Intronic
1133118160 16:3589945-3589967 AGAATCGGGGCTCTTTGGGCAGG - Exonic
1133640858 16:7715973-7715995 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1134407165 16:13970604-13970626 AGAATCTGTGCACTGGGAGTGGG - Intergenic
1137660704 16:50203737-50203759 AGACTCTGTGGACATTGGGGTGG + Intronic
1137793389 16:51194400-51194422 AGAATCTGTGGAATTTTGGTTGG - Intergenic
1138198265 16:55070279-55070301 AGAAACTTCTCACTTTGGGGTGG + Intergenic
1138845063 16:60555000-60555022 AGAGTCTGTGCATTTAGGGGAGG - Intergenic
1139005044 16:62559507-62559529 AGAATCTGTGCACTTCTGTGAGG - Intergenic
1139712784 16:68789285-68789307 ATAATCCCAGCACTTTGGGGAGG - Intronic
1139746012 16:69075096-69075118 GTAATCTGTGCACTTTTGGAAGG - Intronic
1140167014 16:72563165-72563187 ATAATCCCAGCACTTTGGGGAGG - Intergenic
1141151542 16:81567788-81567810 AGAATCTCTGCGCTTCGGGGAGG - Intronic
1142655638 17:1391719-1391741 ATAATCCCTGCACTTTGGGGAGG + Intronic
1144556016 17:16283563-16283585 GTAATCTGAGCACTTTGGGAGGG + Intronic
1145069081 17:19787890-19787912 ATAATCTGTGTACTTGGGGGAGG + Intronic
1145245436 17:21266104-21266126 ATAATCCCAGCACTTTGGGGGGG + Intergenic
1145716429 17:27027386-27027408 ATAATCCCAGCACTTTGGGGAGG - Intergenic
1146216734 17:30982440-30982462 AGAATCTGTGCACTCAGGAAAGG - Intronic
1146233465 17:31134133-31134155 ATAATCCCAGCACTTTGGGGAGG - Intronic
1147216828 17:38905229-38905251 AGAATGTGTGCTCCTTGGGCCGG + Intronic
1147774211 17:42889123-42889145 ATAATCCCAGCACTTTGGGGAGG - Intergenic
1148239236 17:45989027-45989049 AGAATCTTTCCAACTTGGGGGGG + Intronic
1149908058 17:60544914-60544936 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1150541389 17:66103804-66103826 AGAATCTGTGTATTTGGGGAAGG + Intronic
1150550243 17:66203430-66203452 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
1151169689 17:72236385-72236407 GTAATCTGAGCACTTTTGGGAGG + Intergenic
1151522572 17:74640951-74640973 ACAGTCTGTGCTCTTTGGGAAGG + Intergenic
1152496118 17:80673171-80673193 ATAATCCCAGCACTTTGGGGAGG - Intronic
1153129137 18:1834537-1834559 AGAATCTATGCACTTGGGTGGGG + Intergenic
1153236319 18:2991754-2991776 ATAATCTCAGCACTTTGGGAGGG + Intronic
1153903086 18:9636386-9636408 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1153946764 18:10025087-10025109 ATAATCTCAGCACTTTGGGGAGG - Intergenic
1155338810 18:24793475-24793497 ATAATCTCAGCACTTTGTGGGGG + Intergenic
1155376755 18:25167274-25167296 AGATTCTGTGAACTTTGGGCTGG - Intronic
1155767346 18:29652349-29652371 AGAATCTGTGCATTTGGGGGAGG + Intergenic
1155792754 18:29995451-29995473 AGAATCTGTGTGTTTAGGGGAGG + Intergenic
1156094154 18:33509591-33509613 AGAAACTGTGAACTTGGGAGAGG + Intergenic
1156977360 18:43238649-43238671 AAATTCTCTGCACTTTGGAGAGG - Intergenic
1157022744 18:43806099-43806121 AGAATCTGGGTACTTGGGAGAGG - Intergenic
1158596306 18:58819263-58819285 ATAATCTGTGCTCTTTGATGTGG + Intergenic
1158963484 18:62604904-62604926 AGACTCTGTGCTCCTTGGGAAGG + Intergenic
1159260112 18:66003558-66003580 AGAATCTATGCACTTTGTGGAGG + Intergenic
1159490662 18:69129536-69129558 AGAATCTGTGCACTCAGGGGAGG - Intergenic
1159559054 18:69974979-69975001 TGCAGCTGTGCACTTTTGGGTGG + Intergenic
1159647956 18:70942448-70942470 AGAATCTGTGCACTTAGCAGGGG + Intergenic
1159802683 18:72920415-72920437 AGAATGTGTACACTTATGGGAGG - Intergenic
1161126180 19:2559053-2559075 ATAATCCCAGCACTTTGGGGGGG - Intronic
1161411786 19:4121827-4121849 AGGATCGGGGGACTTTGGGGGGG - Intronic
1161624328 19:5317214-5317236 ATAATCTCGGCACTTTGGGAGGG + Intronic
1163010789 19:14424633-14424655 ATAATCCTAGCACTTTGGGGAGG - Intergenic
1164607705 19:29611954-29611976 TGAAGCTTTGCTCTTTGGGGTGG + Intronic
1166036885 19:40174981-40175003 AGAAGCTGAGGCCTTTGGGGAGG - Intergenic
1166093736 19:40526842-40526864 GTAATCCGAGCACTTTGGGGAGG - Intronic
1166527756 19:43523677-43523699 ATAATCCCAGCACTTTGGGGAGG + Intronic
1166757718 19:45203790-45203812 AGAATCTGTGCATTTGGGGTAGG - Intronic
1167075568 19:47246601-47246623 ATAATCCCAGCACTTTGGGGGGG - Intergenic
1168239720 19:55082946-55082968 AGAGTCTGTGCACTGCGGGCTGG + Intronic
926024535 2:9529713-9529735 GTAATCTCAGCACTTTGGGGAGG + Intronic
926518748 2:13883393-13883415 AGAATCTGTGCACAGTGGGAGGG + Intergenic
927008766 2:18880109-18880131 TGCATCTGTCCACTTTTGGGTGG - Intergenic
927598159 2:24415759-24415781 ATAATCCCAGCACTTTGGGGAGG + Intergenic
927926941 2:27020107-27020129 AGAATGAATGAACTTTGGGGTGG + Intronic
928027577 2:27752693-27752715 AATCTCTGTGTACTTTGGGGAGG + Intergenic
928293440 2:30060586-30060608 AGAATCTGTGTGCTTGGGGTAGG + Intergenic
928315539 2:30241717-30241739 ATAATCCTGGCACTTTGGGGAGG - Intronic
928483953 2:31710972-31710994 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
928495744 2:31829743-31829765 AGAATCTGTGCATTTTGGGGAGG - Intergenic
928715652 2:34056716-34056738 AGAATCTGTGCCCTTGGGGGAGG - Intergenic
928864117 2:35896357-35896379 ATAATCTGTGTGCTTGGGGGAGG - Intergenic
929105433 2:38360536-38360558 GGAATCCCAGCACTTTGGGGAGG - Intronic
929805977 2:45145331-45145353 AGACTCTGTGCTGTTAGGGGTGG + Intergenic
930145645 2:48000912-48000934 AGAATCTTTACACGTTGGGTGGG - Intergenic
930230818 2:48842061-48842083 AGAATCTGCACACTTTGGGGAGG - Intergenic
930288946 2:49468789-49468811 AGAATCTGTGCACTTGTAGGAGG - Intergenic
930439788 2:51391239-51391261 AGAATCTGGGCACTTGGGGAGGG - Intergenic
930727228 2:54694211-54694233 AGAATCTGTGCACTTGGGAGAGG + Intergenic
930815702 2:55595372-55595394 ATAATCTCAGCACTTTGGGAGGG + Intronic
930896605 2:56453420-56453442 ATAATCTCAGCACTTTTGGGAGG - Intergenic
931384084 2:61781322-61781344 ATAATCCTAGCACTTTGGGGAGG + Intergenic
931548531 2:63415838-63415860 AGAGCCTGTTAACTTTGGGGTGG + Intronic
931736398 2:65198716-65198738 AGACTCTGTGCCCTTGGGGGAGG + Intergenic
931844167 2:66185531-66185553 AGAATCTTTTCTCTCTGGGGTGG + Intergenic
932170383 2:69550138-69550160 AGTATCTGTGGACTTTGGCCAGG - Intronic
932338170 2:70942918-70942940 AGAAGCTGTGGACTTGCGGGAGG - Intronic
932389412 2:71372470-71372492 AGAGTCTGTGCACTTTAGGAAGG - Intronic
932517451 2:72367712-72367734 AGAGTTTGTGCACTTGGGAGAGG + Intronic
932686373 2:73873970-73873992 ATAATCCAAGCACTTTGGGGAGG - Intergenic
933320074 2:80762727-80762749 AGCATCTGTGCAGTCTTGGGTGG - Intergenic
933446508 2:82386993-82387015 AGAGCCTGTGCACTTAGGGGTGG + Intergenic
933673072 2:85027629-85027651 GTAATCTGAGCACTTTGCGGGGG - Intronic
933921438 2:87051060-87051082 GTAATCTCAGCACTTTGGGGTGG - Intergenic
933930182 2:87142735-87142757 GTAATCTCAGCACTTTGGGGTGG + Intergenic
934001515 2:87718522-87718544 GTAATCTCAGCACTTTGGGGTGG + Intergenic
934870512 2:97860969-97860991 AGAGTCTGTGCACTTGGGAGAGG + Intronic
935070476 2:99689436-99689458 AAAAGCTGTGCCCTTTGGGGTGG - Intronic
935281685 2:101523058-101523080 AGAAGCTGGGCACTTGGGGCTGG + Intergenic
935437958 2:103056918-103056940 ATAGTCTGTACACTTTGGGGAGG - Intergenic
935441982 2:103109619-103109641 ATAATCCCAGCACTTTGGGGAGG - Intergenic
935694906 2:105762555-105762577 GATATCTGTGAACTTTGGGGTGG + Intronic
935750837 2:106232548-106232570 AGAATCTGTGCACATTGGGGAGG + Intergenic
935989254 2:108704763-108704785 AGAATCTGTGTGATTTGGGGAGG + Intergenic
937591119 2:123614460-123614482 AGAACCTGTGTACTTTGGGGAGG + Intergenic
937613675 2:123893925-123893947 AGAATCTGTGCACTTTGAAGAGG - Intergenic
937998341 2:127712138-127712160 ATAATCCCTGCACTCTGGGGGGG + Intronic
938746795 2:134286673-134286695 ATAATCTCAGCACTTTGGGAGGG - Intronic
939253000 2:139707252-139707274 ATAATCTGTGCACTCAAGGGTGG - Intergenic
939273491 2:139970303-139970325 AGAGTCTGTTCACTTAGAGGAGG + Intergenic
940242439 2:151577832-151577854 GTAATCTCAGCACTTTGGGGAGG - Intronic
940559961 2:155282294-155282316 AGAATCTGTATGCTTGGGGGAGG - Intergenic
940629470 2:156219639-156219661 AGAGTCTGTGCACTTGGGGAGGG + Intergenic
940795250 2:158070847-158070869 GGAATCTGAGCACTTTAGGGAGG + Intronic
941047645 2:160694759-160694781 AGAGTCTGTGCATGTCGGGGAGG - Intergenic
941256289 2:163235364-163235386 AGTATGTGTGCAATCTGGGGAGG + Intergenic
941357380 2:164510929-164510951 AGAATCTGTGTACTTGGGAGAGG + Intronic
941746098 2:169088315-169088337 AGAATCTGCGTACTTGGGGTGGG - Intronic
941833050 2:169983515-169983537 ATAATCTCAGCACTTTTGGGAGG - Intronic
941851929 2:170191652-170191674 ATAATCTGTGCACTTGCGGGAGG - Intronic
942382556 2:175407080-175407102 AGAGTCTGTGGGCTTTGGAGCGG - Intergenic
942391896 2:175503382-175503404 AGAAACTGTGCACTTTGGGGAGG - Intergenic
942778602 2:179614037-179614059 AGAATCTGTGCATTTGCGGGAGG - Intronic
942814419 2:180034695-180034717 AGAATCTGTGTACATTGAGGAGG - Intergenic
943117612 2:183692462-183692484 AAAATCTGTGTACTTGGGGAAGG - Intergenic
943520419 2:188942882-188942904 AGAATATGTGCACCTTTGGCAGG + Intergenic
943773282 2:191741597-191741619 GCAATCTCCGCACTTTGGGGGGG - Intergenic
943867050 2:192938511-192938533 AGAATCTGTGCACTTGGAGAAGG - Intergenic
943933487 2:193885286-193885308 GGAATCTGTGCACTTTGAAGAGG + Intergenic
944096055 2:195968951-195968973 AGAATCTGTACACGTCGGGGAGG - Intronic
944133382 2:196370848-196370870 AGAATCTGTGCGCTTAGGGGAGG - Intronic
944200737 2:197104815-197104837 AAAATGTGTGCACTTTGTGAAGG + Intronic
944553851 2:200869044-200869066 ATAATCGCAGCACTTTGGGGAGG - Intergenic
944990649 2:205230958-205230980 AGAATCTGTGCACCTTGGGGAGG - Intronic
945265914 2:207891216-207891238 AGAATCTGTGGTCATGGGGGTGG + Intronic
945334321 2:208573471-208573493 AGAATCTGTGTGCTTGGGGGAGG + Intronic
945754572 2:213830308-213830330 AGAATCTGTGTGCTTTAGGGAGG - Intronic
945803849 2:214465951-214465973 AGAATCTGTGTGCTTGGGGGAGG - Intronic
946509202 2:220335765-220335787 ATAATCTGTGCACTTGCGGCAGG - Intergenic
946651629 2:221897706-221897728 GGAACCTGTGCATTTTGGGGTGG - Intergenic
946697210 2:222371879-222371901 AGAATCTGTGCACTGTGGAGAGG + Intergenic
946841869 2:223827639-223827661 ATAATCTCAGCACTTTGGGAGGG - Intronic
946922243 2:224591956-224591978 AGAGTCTGTGCACTGTAGGGAGG + Intergenic
946999959 2:225442830-225442852 ATAATCTCAGCACTTTGTGGGGG - Intronic
947131033 2:226924827-226924849 AGAATCTGTGTACTTGGGGGAGG - Intronic
947437367 2:230084199-230084221 ATAATCTCAGCACTTTGGGAAGG - Intergenic
947439864 2:230109787-230109809 GCGATCTGTGCACTTTAGGGAGG - Intergenic
947505346 2:230704263-230704285 AGAATCTGTGGTCTTGGGTGAGG - Intergenic
1169623820 20:7540180-7540202 AGAATCTGTGTGCCTGGGGGAGG + Intergenic
1170098782 20:12675713-12675735 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1170668261 20:18405866-18405888 AGAATGTGTGCACTTTGGGGAGG + Intronic
1170709365 20:18776147-18776169 AGAATCTGTGCACTTAGAGGAGG - Intergenic
1170986127 20:21260717-21260739 GGGATCTGTGCACTGTTGGGGGG - Intergenic
1171341783 20:24435031-24435053 GTAATCTGAGCACTTTGGGAGGG - Intergenic
1171541609 20:25961970-25961992 ATAATCTCAGCACTTTTGGGAGG + Intergenic
1171780604 20:29414013-29414035 AGGAGCTGTGGACTGTGGGGAGG + Intergenic
1171799456 20:29598378-29598400 ATAATCTCAGCACTTTTGGGAGG - Intergenic
1174240680 20:49132175-49132197 AGAATCTCTGCCCTTGGGTGTGG - Intronic
1175223016 20:57428371-57428393 ATAATCCCAGCACTTTGGGGAGG - Intergenic
1176015908 20:62932128-62932150 ACAATCCCAGCACTTTGGGGAGG - Intronic
1176940063 21:14912657-14912679 AGAATCTGTGCACGTTGGGGAGG - Intergenic
1176994856 21:15543639-15543661 AGAATCTGTGCACTTATGGGAGG + Intergenic
1177212763 21:18091022-18091044 AGACTCTGCTCACTTTGGGGAGG + Intronic
1177222334 21:18210311-18210333 AGAATCTGTGCACATCGGGGAGG - Intronic
1177276089 21:18914216-18914238 AGAATCTGAGCACTTAGGGGAGG - Intergenic
1177539732 21:22477089-22477111 AGAATCTGTGTGTTTTGGGAAGG + Intergenic
1177707229 21:24722454-24722476 CGGAAGTGTGCACTTTGGGGTGG - Intergenic
1177760651 21:25399326-25399348 AGAATCTGTGTGCCTGGGGGAGG + Intergenic
1177771190 21:25518545-25518567 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
1178528960 21:33358741-33358763 ATAATCTCAGCACTTTTGGGAGG + Exonic
1178622249 21:34186960-34186982 ATAATCTCAGCACTTTTGGGAGG - Intergenic
1180688645 22:17691120-17691142 GTAATCTTAGCACTTTGGGGAGG - Intronic
1181090983 22:20472468-20472490 ATAATCTCAGCACTTTGGGAGGG + Intronic
1181716741 22:24736746-24736768 AGAATCTGTGCAGTTGGGAGAGG + Intronic
1183159411 22:36101788-36101810 ATAATCCCTGCACTTTGGGAGGG - Intergenic
1184977837 22:48075739-48075761 AGAATCAGGGCACGGTGGGGAGG + Intergenic
1185363161 22:50421461-50421483 ATAATCCCAGCACTTTGGGGGGG - Intronic
949273246 3:2246223-2246245 AGAATCTAAACATTTTGGGGAGG - Intronic
949540637 3:5029352-5029374 ATAATCCCGGCACTTTGGGGAGG - Intergenic
949557637 3:5170985-5171007 GGAATCCCAGCACTTTGGGGAGG - Intronic
949596865 3:5557209-5557231 AAAATCTGTGCAACTTGAGGTGG + Intergenic
949623100 3:5838035-5838057 AGAATCTGTGTGCTTGGGGAAGG - Intergenic
950382628 3:12630036-12630058 ATAATCCTAGCACTTTGGGGAGG - Intronic
950766072 3:15273985-15274007 GGAATCCCAGCACTTTGGGGAGG + Intronic
950801200 3:15552994-15553016 AGAATCTGTGCATTTAGGGGAGG - Intergenic
950815016 3:15691871-15691893 ATAATCCCAGCACTTTGGGGAGG + Intronic
951029402 3:17864144-17864166 AGAATCTTTGTACTTGTGGGAGG - Intronic
951172259 3:19555568-19555590 AGAGTCTGTGGACTTGGAGGAGG - Intergenic
951210996 3:19974662-19974684 ATAATCTCAGCACTTTTGGGAGG + Intronic
951260022 3:20496240-20496262 AGAATCTGTGTACTTTGGGAAGG - Intergenic
951279670 3:20732366-20732388 AGAATCTGTGTAGTTGGGGAAGG - Intergenic
951310372 3:21117823-21117845 AGAATCTGTGCACTTGGAGGAGG - Intergenic
951437099 3:22677208-22677230 AGAATCTGTGTGCTTGGGGCAGG - Intergenic
952062157 3:29523991-29524013 ATAATCTCAGCACTTTTGGGAGG - Intronic
952066564 3:29577739-29577761 AGAGTCTGTGCATTTGAGGGAGG - Intronic
952272412 3:31846266-31846288 ATAATCTCAGCACTTTGGGGAGG - Intronic
952672923 3:35993138-35993160 AGAATCTGTTCACTTGAGGGAGG + Intergenic
952784020 3:37134401-37134423 AGAATTTGTGGATTTGGGGGTGG + Intronic
953217120 3:40930131-40930153 AGAATCTGTGTGCTTTGAAGAGG + Intergenic
953362515 3:42310299-42310321 AGAACCTGTGCCCTTTGGGGAGG - Intergenic
953915156 3:46914523-46914545 ATAATCTGAGCACTTTGGGAGGG + Intergenic
954213154 3:49109475-49109497 TGAATCGGTGTCCTTTGGGGAGG - Intronic
954491481 3:50910729-50910751 ACAATCTGTGTACTTGGGGGAGG - Intronic
955261492 3:57395687-57395709 ATAATCTGAGCACTTTGAGAGGG + Intronic
955274495 3:57534185-57534207 AGAATCTGTGCACTTGGGGATGG - Intronic
955855254 3:63266061-63266083 AGCATCTGTGAACTTTGGCCAGG - Intronic
956222766 3:66922265-66922287 AGAATCAGTGCACTTTGGGGAGG + Intergenic
956685573 3:71824541-71824563 AAAATCTGTTTGCTTTGGGGAGG + Intergenic
957018978 3:75102134-75102156 AAAATCTGTGCACTTCAGTGAGG - Intergenic
957190969 3:77009700-77009722 ATAATCCCAGCACTTTGGGGAGG + Intronic
957485586 3:80858393-80858415 ATAATCTGTGCACTTGATGGAGG + Intergenic
957538101 3:81532040-81532062 AGAATCTGTTTGCTTAGGGGAGG - Intronic
957907716 3:86578972-86578994 AGTGTCTGTGCCCTTTGGGGAGG - Intergenic
957977085 3:87460558-87460580 AGAATCTGTGTGCTTAGGGAAGG + Intergenic
958099281 3:88988519-88988541 AAAATCTGTGCACTCAGGAGAGG + Intergenic
958410727 3:93812346-93812368 AGAATCTGGGAATTGTGGGGAGG + Intergenic
958765989 3:98368355-98368377 ACAATCTGTGTGCTTGGGGGAGG - Intergenic
958839401 3:99185906-99185928 AGAATCTGTGTGCTTGAGGGAGG + Intergenic
959189960 3:103098204-103098226 AGAATCTGTGCATTTGGGAGAGG - Intergenic
959191067 3:103112379-103112401 AAAATCTGTGCACTTTAAGGAGG + Intergenic
959335971 3:105065978-105066000 AGAATCTGTGCACTTTGCAGAGG + Intergenic
959409154 3:105998419-105998441 AGAATCTGTGTCCTTGGGGGAGG - Intergenic
959474239 3:106790156-106790178 AGAATCTGTGCAATTGGGGAGGG + Intergenic
960182601 3:114599092-114599114 AGAACCTGTGTAATTTAGGGAGG - Intronic
960354055 3:116629264-116629286 AGAATCTGTATGCTTGGGGGAGG - Intronic
960404026 3:117238042-117238064 AGAATCTGTGTGCTTGGGGAAGG + Intergenic
960471950 3:118076395-118076417 AGAATCTGTGTGCTTAGGGGAGG - Intergenic
960627469 3:119695149-119695171 GTAATCTCAGCACTTTGGGGAGG + Intergenic
960862918 3:122169520-122169542 AGACTCTGTGCACTTGGAGGAGG - Intergenic
961133019 3:124486393-124486415 AGAATCTGAGAACTTTAGGTTGG + Intronic
961964547 3:130888655-130888677 AGAGTATATGCACTTGGGGGAGG - Intronic
962015041 3:131430928-131430950 AAAATCTGTGTACTCGGGGGAGG + Intergenic
962319376 3:134377982-134378004 GGAATGTGTGCAGTTTGGAGAGG - Intergenic
962483211 3:135815792-135815814 AGAATCTGTGTGCTTTGGGGAGG + Intergenic
962620879 3:137177273-137177295 ATAATCTTAGCACTTTGGGAGGG + Intergenic
962875772 3:139535180-139535202 AGAGCCTCTGCCCTTTGGGGAGG + Intronic
963154019 3:142077023-142077045 AGAATCTATGCACCTGGGGGAGG + Intronic
963443613 3:145373884-145373906 AGAATCTGTGCTCTCGAGGGAGG + Intergenic
963457907 3:145569856-145569878 AGTATCTGTGCACTTTCGTTAGG - Intergenic
963572032 3:147009397-147009419 AGAATCTGTGTGCTTGGGGAAGG - Intergenic
963659887 3:148112281-148112303 AGAGAATGTGCACTTGGGGGTGG + Intergenic
963701280 3:148629966-148629988 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
963979981 3:151526861-151526883 AGAATGTGTGCACACTGGAGAGG + Intergenic
964021673 3:152021056-152021078 AGAATCTGTGCACTTGGGAAAGG + Intergenic
964151559 3:153531733-153531755 AGAATATGTGCACTTAGGGGAGG + Intergenic
964259040 3:154812411-154812433 AGAATCTGTGCACTTGGGAGAGG - Intergenic
964349687 3:155790641-155790663 AGAATCTATGCACTTGGATGGGG + Intronic
964398557 3:156273539-156273561 AGCATCTGTGTGCTTAGGGGAGG - Intronic
964583011 3:158260886-158260908 AGAATCTGTGCACTTGGGGGAGG - Intronic
964803993 3:160587119-160587141 AGAATCTGTGTGCTTGGGGAGGG + Intergenic
964961048 3:162427324-162427346 AGAATCTGCGTGCTTAGGGGAGG + Intergenic
965020206 3:163218871-163218893 AGAATCTGTGTGCTTGAGGGAGG - Intergenic
965156009 3:165056585-165056607 AGAATCTGTGCACTTTCTGAAGG + Intronic
965175346 3:165323211-165323233 AGAATCTGTGGACTTGGCAGAGG - Intergenic
965322381 3:167265913-167265935 AGAATCTGTGCTCTCTGGGGAGG - Intronic
965358522 3:167708480-167708502 ACAATCTGTTCACTGTGGGTAGG - Intronic
965379139 3:167966755-167966777 AGAATCTGTGTGCTTGGGGTAGG + Intergenic
965415304 3:168385181-168385203 AGAGTCTGTGCTCTTGGGGAAGG - Intergenic
965547968 3:169934595-169934617 AGAATCTGTGCTTTTGTGGGTGG + Intronic
965790948 3:172387351-172387373 ATAATCCCTGCACTTTGGGAGGG - Intronic
965853939 3:173065678-173065700 AGAATCTGTGTGCTTGCGGGAGG + Intronic
965867137 3:173217620-173217642 AGTATCTGTGCACTTGAGGGAGG - Intergenic
965980184 3:174681011-174681033 AGAATCTGTGTGCTTGGAGGAGG + Intronic
966172306 3:177095736-177095758 ATAATCCCAGCACTTTGGGGAGG - Intronic
966467064 3:180241625-180241647 GGACTTTGGGCACTTTGGGGAGG - Intergenic
966920527 3:184608464-184608486 AGCATCTGTGCACTGTGTGGTGG + Intronic
967608829 3:191481034-191481056 AGAATCTGTGCACTTGGGAGAGG + Intergenic
969200631 4:5602017-5602039 ATAATCCCTGCACTTTGGGAGGG + Intronic
969228346 4:5813462-5813484 CTAATCTCAGCACTTTGGGGAGG - Exonic
970595001 4:17591958-17591980 CAAATGTGTGCACCTTGGGGGGG + Intronic
970963230 4:21897939-21897961 AGAATCTGTGTGTTTGGGGGAGG + Intronic
971329661 4:25672076-25672098 ATAATCCCAGCACTTTGGGGAGG + Intronic
972009433 4:34158438-34158460 AGAATTTGTGGACTTTGAAGAGG + Intergenic
972021542 4:34322462-34322484 AGAATCTGTGCCCTTGAGGGAGG + Intergenic
972125402 4:35758951-35758973 AAAATCTGTGCACTTTGGGGAGG - Intergenic
972271203 4:37512055-37512077 AGAATCTGTGCACTTGAAAGAGG - Intronic
972477645 4:39466229-39466251 ATAATCTCAGCACTTTGGGAGGG - Intronic
973227342 4:47801605-47801627 AGAATGTGGGCACTTGGGAGAGG + Intronic
973287949 4:48440448-48440470 AGAACCTCTGTGCTTTGGGGAGG - Intergenic
973793288 4:54397658-54397680 ATAATCTGAGCACTTTTGGGAGG + Intergenic
973852657 4:54976739-54976761 AGAATCTGTGCACTTTGGGGAGG + Intergenic
974266901 4:59597685-59597707 AGAATCTGTGTGCTTGGGGAAGG + Intergenic
974299354 4:60043008-60043030 AGTGTCTGTGCATTTGGGGGAGG - Intergenic
974415084 4:61595979-61596001 AGTATTTGTGCACTTTGGGGAGG - Intronic
974469544 4:62301583-62301605 AGAAAATTTGCACTTTGGGGAGG + Intergenic
974609203 4:64193230-64193252 AGAATCTGTGCACTTGAGAGAGG - Intergenic
975040128 4:69736026-69736048 AGAATCTGTGCACTTGGGAGAGG + Intronic
975910181 4:79258322-79258344 AGCATCGTTGCACTTTGCGGGGG + Intronic
976040973 4:80885030-80885052 AGAATCTGTGAGCTTTGGGGAGG + Intronic
976253995 4:83082015-83082037 ATAATCCCAGCACTTTGGGGAGG - Intergenic
976444008 4:85109728-85109750 AGAATCTGTGCACTTGAGGGAGG + Intergenic
976728615 4:88240714-88240736 AGAATCTGTGCACTTGGGAGAGG - Intergenic
976908189 4:90266646-90266668 AGAATCTGTGCTTCTGGGGGAGG + Intronic
976981950 4:91243079-91243101 AGAATCTGTGTACTTTGGAGAGG + Intronic
977307330 4:95341833-95341855 AGAATCTGTGTCCTTGGGGGAGG + Intronic
977341442 4:95763744-95763766 AGAATCGGTGCACTCAAGGGAGG + Intergenic
977397163 4:96485097-96485119 AGAATCTGTGCACTTGAAAGAGG - Intergenic
977477472 4:97530814-97530836 AGAGTTTGTGCACTTTGGGGAGG + Intronic
977521736 4:98093725-98093747 AGAATCAGTACATTTTGGAGAGG + Intronic
977527945 4:98166893-98166915 AGAATCTGTGCTCTTGAGGGAGG - Intergenic
977644386 4:99395625-99395647 ACAATCTGTGTGCTTGGGGGAGG + Intergenic
978111917 4:104974847-104974869 ATAATCTTTGCACTTTGAGGAGG + Intergenic
978594583 4:110362990-110363012 ATAATCCCAGCACTTTGGGGGGG - Intergenic
978733683 4:112061306-112061328 AGAATCTGTGCATTTGGGGGAGG + Intergenic
979042821 4:115819707-115819729 AAAATCTTTGGACTTTGGAGTGG - Intergenic
979565191 4:122146481-122146503 AGAATCTGTATACTTGGGGAAGG - Intergenic
979888514 4:126061787-126061809 TGCAGCTGTCCACTTTGGGGAGG + Intergenic
979945722 4:126829515-126829537 AGAATCTGTGTGCTTGGGGCAGG + Intergenic
980172530 4:129306637-129306659 AGAATCTGTGCACTTTGGGGAGG - Intergenic
980538284 4:134159474-134159496 AGAATCTGTGTGCTTTGGGGAGG + Intergenic
980596824 4:134965898-134965920 AGAATCTGTGTGCTTGGGGAAGG + Intergenic
980682800 4:136186534-136186556 AGAATCTCTGTACTTGGGGAAGG + Intergenic
980752909 4:137115732-137115754 AGAATCTGTGTTCTTGGGGGAGG + Intergenic
981031767 4:140132481-140132503 GGAAACTCTGGACTTTGGGGAGG + Intronic
981140119 4:141258657-141258679 AGAATCTCTGCACTTAGGGGAGG + Intergenic
982018981 4:151184808-151184830 AGAATATGTGGAAGTTGGGGCGG - Intronic
982054038 4:151529651-151529673 ATAACCTGTGCCCTTTGTGGGGG + Intronic
982339719 4:154284569-154284591 AGAATCTGTGCACTTGGGAGAGG + Intronic
982576570 4:157118551-157118573 ATGATCTATGCACTTTTGGGAGG + Intronic
982683491 4:158459962-158459984 AGAATCTGTGCACTTTGGGAAGG - Intronic
982828406 4:160028294-160028316 AGAGTCTGTGCACTTGGGGAGGG - Intergenic
983234860 4:165167684-165167706 AGAATCTGTGCATAATGAGGAGG - Intronic
983338185 4:166422044-166422066 AGAGTCTGTGTACTTAAGGGAGG - Intergenic
983493001 4:168411396-168411418 AGAGTCTGTGCACTTGGAAGAGG + Intronic
983755376 4:171328630-171328652 AGAAGCTGTGTACTTGTGGGAGG + Intergenic
983960324 4:173744937-173744959 AGTAACTGTGCATTTTAGGGTGG - Intergenic
984206611 4:176793224-176793246 AGAAACTGGGCACCGTGGGGTGG + Intergenic
984529881 4:180902757-180902779 CGAATCTGTACACTTTGGGGAGG - Intergenic
985384862 4:189434644-189434666 AGAGTCTGTGCATGTTGGGGAGG - Intergenic
986045866 5:4037064-4037086 AGAATCTGTGCAAGATGGTGCGG - Intergenic
986631307 5:9776266-9776288 AGAATCCATGCACTTGGGGGAGG - Intergenic
987564180 5:19563898-19563920 AGAATCTGTGCACTTTGGGGAGG + Intronic
987886181 5:23815884-23815906 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
987903773 5:24050008-24050030 AAAATCTGTGCACTTGTGGGAGG + Intronic
988082622 5:26433017-26433039 ATAATCTGTTCACTTGGGGGAGG + Intergenic
988265431 5:28942686-28942708 AAAATCTGTGTCCTTGGGGGTGG - Intergenic
988373302 5:30400649-30400671 ATAATCCCTGCACTTTGGGAGGG - Intergenic
988777059 5:34486535-34486557 ATAGTCTGTGAATTTTGGGGTGG - Intergenic
988931591 5:36040516-36040538 AGAATCTGTGTGCTTAGGGGAGG + Intronic
989657818 5:43762890-43762912 AGAATCTGTGCACTTGGAGGAGG - Intergenic
990202967 5:53398331-53398353 AGAATCTGTGCGCTTGGGGAAGG - Intergenic
990213994 5:53510753-53510775 AGAATCTGTGTGCTTGGGGAGGG + Intergenic
990214396 5:53514351-53514373 AGAATCTGTGTGCTTGGGGAGGG - Intergenic
990454335 5:55970428-55970450 ATAATCTCAGCACTTTTGGGAGG + Intronic
990899844 5:60738549-60738571 AGAATCTGTGCACTTTAGGGAGG + Intergenic
991237574 5:64417479-64417501 AGAATCTGTGCACTTCGGAGAGG + Intergenic
992579323 5:78155262-78155284 AGAATCTCTGCACTAGGGGGAGG - Intronic
992934414 5:81687171-81687193 AGAATCTGTGCCATTGTGGGAGG + Intronic
993017061 5:82545865-82545887 AGCATTTGTTCACTGTGGGGTGG - Intergenic
993171139 5:84420202-84420224 ATAATCTGTGCACTTGGGAGAGG - Intergenic
993205670 5:84875452-84875474 AGTATCTGTGCATTTAGGGAAGG + Intergenic
993256978 5:85604451-85604473 AGAATCTGTGTCCTTGGGGGAGG + Intergenic
993380215 5:87198407-87198429 ATAATCCCAGCACTTTGGGGAGG + Intergenic
993542552 5:89170725-89170747 GTAATCTTAGCACTTTGGGGGGG + Intergenic
993932318 5:93954977-93954999 AGAATCTGTGCATTTGGGGGAGG - Intronic
994028470 5:95113455-95113477 AGAATCTGTGCACTTGGAAGTGG + Intronic
994226045 5:97253151-97253173 AGAATCAGTGCACTTTGGGGAGG + Intergenic
994763958 5:103892654-103892676 ACAATCTCAGCACTTTGGGAGGG - Intergenic
994881193 5:105498572-105498594 ACAGTCTGTGCACTTTGGGGAGG - Intergenic
995044089 5:107623903-107623925 ATAATCTTTGGAATTTGGGGAGG - Intronic
995265181 5:110151819-110151841 AGAATCTGTGTACTTTGGGGAGG + Intergenic
995268744 5:110195749-110195771 AGAATCTGTGCACTCAGGGGAGG - Intergenic
995290377 5:110444394-110444416 AGAGTCTGTGCACTTGGGGGAGG - Intronic
995427680 5:112043340-112043362 TGGAGCTGTCCACTTTGGGGTGG + Intergenic
995697910 5:114900409-114900431 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
996166517 5:120229846-120229868 AGAGTCTGTGCATCTGGGGGAGG - Intergenic
996210031 5:120797780-120797802 AGAATCTGTGCCATTGGGAGAGG + Intergenic
996659859 5:125988974-125988996 AGAATCTGTGTGTTTCGGGGAGG - Intergenic
996944908 5:129055388-129055410 AGAATCTGTGCATTTAGGGAAGG + Intergenic
996956291 5:129187083-129187105 AGAATCTGTGTGCCTTGGGGAGG + Intergenic
997354373 5:133252921-133252943 AGAAGATGTGCACTTTGCGCAGG + Intronic
997504362 5:134405038-134405060 ATAATCCCAGCACTTTGGGGAGG - Intronic
997673403 5:135694840-135694862 ATAATCTCAGCACTTTGGGAGGG - Intergenic
997689436 5:135815750-135815772 AGAATATCTGCACTCTGGGAAGG - Intergenic
998511732 5:142719448-142719470 AAAATCTGTACACCTTTGGGTGG + Intergenic
998633917 5:143931461-143931483 AGAATCTGTGCACTTTGGAAAGG + Intergenic
999409071 5:151334432-151334454 GTAATCTCAGCACTTTGGGGGGG + Intronic
999667307 5:153926732-153926754 AGAATCCATGCACTTGGGAGTGG + Intergenic
1000417018 5:160994286-160994308 TGCAGCTGTCCACTTTGGGGTGG - Intergenic
1001304511 5:170561823-170561845 AGCATCTGTACACTCTGTGGGGG - Intronic
1001845252 5:174916425-174916447 AGAATCTACGCACTTGGGGGAGG + Intergenic
1002009882 5:176270649-176270671 AGAATCTGTGTGCTTGGGGAAGG + Intronic
1002305666 5:178281132-178281154 AGAATCTGGGGATTGTGGGGTGG + Intronic
1002440459 5:179261915-179261937 AGAGGCTGTGCTCTGTGGGGCGG - Intronic
1002612392 5:180429680-180429702 GTAATCTTAGCACTTTGGGGAGG + Intergenic
1005022216 6:21429287-21429309 AGCTTCTGTGCACCCTGGGGTGG + Intergenic
1005037530 6:21570376-21570398 ATAATCAGTGCACTTGAGGGCGG - Intergenic
1005237423 6:23781046-23781068 AAAATATGTTCACTTTGGGGAGG - Intergenic
1005279892 6:24262161-24262183 AGAATCTGTGTGCTTAGGGGAGG + Intronic
1005511205 6:26513050-26513072 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1006018800 6:31104341-31104363 AGAGTCTTTGCATTTTGGGGAGG - Intergenic
1007001773 6:38320100-38320122 AGAATCCGTGCATTTGGGGGAGG - Intronic
1007022206 6:38532113-38532135 GGAATCTGTGCAATTAGGAGAGG + Intronic
1007590254 6:43016730-43016752 AGAATCTGTGTTCTTTGAGGTGG - Intronic
1008192264 6:48474818-48474840 AGAATCTGTACACTCCGGGGAGG + Intergenic
1008707665 6:54182338-54182360 AGAGTCTGTGCACTTGGGAAAGG - Intronic
1008728597 6:54452575-54452597 GTAATCCCTGCACTTTGGGGAGG + Intergenic
1008822651 6:55651915-55651937 AGAATCTGTGCACTTTGGGAAGG - Intergenic
1008848686 6:55997734-55997756 AGAATCTGTATGCTTAGGGGAGG - Intergenic
1008979979 6:57472132-57472154 TGAAACTGTGCACTTTGGCTGGG + Intronic
1009039465 6:58159122-58159144 AAAATCTGTGCATTTGGGAGAGG - Intergenic
1009215357 6:60913962-60913984 AAAATCTGTGCATTTGGGAGAGG - Intergenic
1009375378 6:62961732-62961754 AGAATCTGTGTACTTGAAGGAGG - Intergenic
1009618325 6:66039120-66039142 AGAATCTGTTCACTTGGGAGAGG + Intergenic
1009744732 6:67798278-67798300 AAAATCTGTGCACTTTGAGGAGG + Intergenic
1010062275 6:71636498-71636520 AGAATCTGTGCACTTGAGCGAGG - Intergenic
1010560422 6:77341860-77341882 AGAGTTTGTGCACTTGGGAGAGG - Intergenic
1011018855 6:82788586-82788608 AGAATCTGTGCATTCAGAGGAGG + Intergenic
1011359818 6:86511390-86511412 ATAATCTGTGTGCTTTGGGAGGG - Intergenic
1011442186 6:87398934-87398956 ATAATCTCAGCACTTTGGGAGGG + Intronic
1011446858 6:87450868-87450890 AGAATCTGTGTACTTGGTGGAGG + Intronic
1011774064 6:90708483-90708505 AGAATTTGGGAACTTGGGGGAGG - Intergenic
1011810105 6:91121567-91121589 ATAATCCCTGCACTTTGGGAGGG - Intergenic
1012057116 6:94427172-94427194 AGAATCTGTGTGCTTGGGGAAGG - Intergenic
1012642475 6:101636738-101636760 ATAATATTTGCATTTTGGGGGGG + Intronic
1012646582 6:101691385-101691407 AGAATCTCTGCAATCTGGGGAGG - Intronic
1012712796 6:102629455-102629477 AGAATCTTTGTGCTTGGGGGAGG - Intergenic
1012783127 6:103589082-103589104 AAAATCTGTGTTCTTGGGGGAGG - Intergenic
1012827230 6:104162153-104162175 AGAAACTGTGTGCTTGGGGGAGG + Intergenic
1012875914 6:104725934-104725956 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1013530131 6:111011542-111011564 ATAATCTCAGCACTTTTGGGAGG - Intronic
1014234512 6:118939572-118939594 AGAATCTGTGCACTTGGGAGAGG + Intergenic
1014275611 6:119384896-119384918 AAAATCTGCGCACTTGGTGGAGG - Intergenic
1014378649 6:120711137-120711159 AGAATCTGTGCACTTGGGGACGG + Intergenic
1014697725 6:124644658-124644680 ATAATCCCAGCACTTTGGGGGGG - Intronic
1014830656 6:126099235-126099257 TAAATCTGTGCACTTTGGTGTGG + Intergenic
1014840905 6:126219027-126219049 AGAATCTATACACTTTGGGGAGG - Intergenic
1015287256 6:131500706-131500728 TGAATCTGTAAATTTTGGGGGGG + Intergenic
1015460593 6:133487066-133487088 AGAATCTGTGCACTTGGGGGAGG + Intronic
1015907170 6:138129257-138129279 AGAATCTGTGTGCTTAGAGGAGG + Intergenic
1016087422 6:139931269-139931291 AGAATTTGTGCAGTTTTGAGAGG - Intergenic
1016299578 6:142615131-142615153 AGGATCTGATAACTTTGGGGGGG + Intergenic
1016541374 6:145169948-145169970 AGAATCTGTGTGCTTGGGGAAGG + Intergenic
1017677809 6:156832201-156832223 TGAGTCTGTGTTCTTTGGGGAGG + Intronic
1017883169 6:158576014-158576036 AGAATCTGTGAAGCTTGGAGAGG + Intronic
1018765696 6:166931536-166931558 AGAATGTGTCCACCGTGGGGAGG - Intronic
1020248682 7:6450096-6450118 GTAATCTCAGCACTTTGGGGAGG + Intronic
1020248808 7:6450811-6450833 ATAATCTCAGCACTTTGGGGAGG + Intronic
1020577087 7:9947090-9947112 AAAATCTGTGTGCTTTGGAGAGG + Intergenic
1020607487 7:10357035-10357057 AGAATCTGTACACTTTTGAGAGG - Intergenic
1020624113 7:10557452-10557474 AGAATCTGGGCACTTGGGAGAGG + Intergenic
1020666351 7:11048315-11048337 GAAATCTCAGCACTTTGGGGAGG + Intronic
1020999182 7:15306454-15306476 GCAATCAATGCACTTTGGGGTGG + Intronic
1021169327 7:17379452-17379474 GGAAAGTGTGCACGTTGGGGTGG + Intergenic
1021211791 7:17863012-17863034 AGAATCTGTGGGCTTGTGGGAGG + Intronic
1021214743 7:17901629-17901651 AAAATCTGTGCACTTAGGGGAGG - Intronic
1021677460 7:23096264-23096286 ATAATCTTAGCACTTTGGGAGGG + Intergenic
1021922976 7:25505693-25505715 AGAATCTGTGCACTTGGGTGAGG + Intergenic
1022749994 7:33214310-33214332 AGAGTCTGTGCACTTCATGGAGG - Intronic
1023012180 7:35934018-35934040 AGAATCTGTGGAGATGGGGGAGG + Intergenic
1023646159 7:42318251-42318273 AGAATCTATGCATTTTGGGGAGG + Intergenic
1024078943 7:45839842-45839864 AGAATCTGTGGAGATGGGGGAGG - Intergenic
1024170176 7:46777297-46777319 AGAATATGTCCACTTGGGAGAGG + Intergenic
1024369226 7:48560343-48560365 GGAATCTGTGCACTTGGGGGAGG - Intronic
1024705960 7:51959805-51959827 AGAATCTGTGCACTTTGGGGAGG - Intergenic
1024908802 7:54421193-54421215 AGAATCTGCTCATTTAGGGGAGG + Intergenic
1025061533 7:55812828-55812850 AGAATCTGTGTGTTTTGGGGAGG + Intronic
1025135620 7:56409432-56409454 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1026766413 7:73162678-73162700 GTAATCTCAGCACTTTGGGGAGG - Intergenic
1026869325 7:73841107-73841129 AGGATCAGGGCACTGTGGGGCGG + Exonic
1027042886 7:74972374-74972396 GTAATCTCAGCACTTTGGGGAGG - Intronic
1027080757 7:75229983-75230005 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1027523952 7:79244431-79244453 AGAGTCTGTGCAACTGGGGGAGG + Intronic
1027943989 7:84722701-84722723 AGAATCTGTGCATCTGGGGTTGG - Intergenic
1028181382 7:87729406-87729428 AAAATCTGTGCATTCAGGGGAGG + Intronic
1028207665 7:88034839-88034861 AGAAACTGTGCACTTAGGCAAGG - Intronic
1028213903 7:88108470-88108492 ATAATCCCAGCACTTTGGGGGGG + Intronic
1028238481 7:88389664-88389686 AGAACGTGTGCTCTTTGGGAGGG + Intergenic
1028266702 7:88734325-88734347 AGAATCTGTGCACTTAGGGGAGG - Intergenic
1028307864 7:89289529-89289551 AGAATCTGTGTACTTGAGAGAGG + Intronic
1028353522 7:89879034-89879056 AGAATCTGTGTGCTTGGGGTAGG - Intergenic
1028522137 7:91743055-91743077 AGAATCTGTGTTCTTGGGAGAGG - Intronic
1029042614 7:97593415-97593437 AGAATCTGTGCACTTTGGTGAGG - Intergenic
1029211360 7:98910788-98910810 AGAGTCTGTGCATTTTTGAGGGG + Intronic
1029365919 7:100116264-100116286 GTAATCTGTGCACTTTGGGAGGG + Intronic
1029650985 7:101891478-101891500 ATAATCCTAGCACTTTGGGGAGG - Intronic
1030314098 7:108096674-108096696 AGAATCCCAGCACTTTGGGAAGG + Intronic
1031098362 7:117448171-117448193 AGAATTTGTGTGCTTTGGGGAGG + Intergenic
1031168509 7:118261108-118261130 GTAATCTCAGCACTTTGGGGAGG - Intergenic
1031259971 7:119506453-119506475 ACAATCTGTGCATTCAGGGGAGG + Intergenic
1031353584 7:120763905-120763927 AGAATCTGTGTATTTAGGGGAGG - Intergenic
1031474401 7:122204970-122204992 TGCAGCTGTCCACTTTGGGGTGG + Intergenic
1031565835 7:123296153-123296175 AGAATCTGTATGCTTGGGGGAGG + Intergenic
1031862193 7:126993654-126993676 AGAATCTGTACACTTGGGGGAGG + Intronic
1031878227 7:127165853-127165875 AGAAGCTGCTAACTTTGGGGAGG + Intronic
1032287832 7:130556018-130556040 AGAGTGTGAGCATTTTGGGGTGG + Intronic
1033291298 7:140085337-140085359 CAAATCTGTGAACTTTGGAGAGG - Exonic
1033629929 7:143147641-143147663 AGAATGTGTCCCCTTTGGAGTGG - Intergenic
1033875293 7:145810334-145810356 AGAATCTGTGCACCCAGGAGAGG + Intergenic
1034076861 7:148240422-148240444 AGAATATTAGCAGTTTGGGGTGG + Intronic
1034431611 7:151043920-151043942 TGAAGCTGTGCACTTGAGGGTGG - Intronic
1035138975 7:156738155-156738177 AGAATCTGTGTACTTGGGGGAGG + Intronic
1035199761 7:157254652-157254674 ATAATCCTGGCACTTTGGGGAGG - Intronic
1036467131 8:9009785-9009807 ATAATCTCAGCACTTTGGGAGGG - Intronic
1037254736 8:16941114-16941136 AGACTATGTGCACTTTGGAGAGG + Intergenic
1037267394 8:17079748-17079770 ATAATCTCAGCACTTTTGGGAGG - Intronic
1037321297 8:17645901-17645923 AGAGTCTGTGGACTTTGGGGAGG + Exonic
1037621808 8:20570490-20570512 AGACTTTGAGCACTTTGAGGTGG - Intergenic
1038270969 8:26075722-26075744 AGTGTATGTGCATTTTGGGGGGG + Intergenic
1039462695 8:37759347-37759369 AGACTCTGTGCTGTTTGGGATGG + Intergenic
1039656241 8:39411373-39411395 AGAGGCTGTGCTCTTGGGGGAGG + Intergenic
1039790909 8:40874992-40875014 AGCATATGTGCATTTTGGGGGGG - Intronic
1040485613 8:47868848-47868870 AGAAGCTGTGCACTTGGGGGAGG + Intronic
1040721105 8:50324290-50324312 AGAATCTGTGCATCTTGGGGAGG - Intronic
1041177983 8:55216985-55217007 ATAATCTCAGCACTTTGGGAGGG + Intronic
1041580018 8:59447693-59447715 AGAATCTGTGCACTTTGGGGAGG - Intergenic
1041615909 8:59906849-59906871 AGAATCTGTGTGCTTAGGGGAGG + Intergenic
1041744883 8:61197898-61197920 AGAGTCTGTGCACTTTGGGGAGG - Intronic
1042162518 8:65911800-65911822 AAAATCTGTGTGCTTGGGGGAGG + Intergenic
1042297821 8:67241887-67241909 AAAATCTGTGTACTTGGGAGAGG + Intronic
1042428071 8:68672441-68672463 AGAATCTGTGGGCTTAGGGAGGG + Intronic
1042509923 8:69600412-69600434 AGGATATTTGCTCTTTGGGGTGG + Intronic
1043041969 8:75275202-75275224 AGAATCTGTGCACCTGGGGGAGG + Intergenic
1043600221 8:81928598-81928620 AGAATCTGTGTACTCTGGGGAGG + Intergenic
1044068765 8:87729037-87729059 ACAATCTGTGCACCTCAGGGTGG + Intergenic
1044124162 8:88437322-88437344 AGAATCTGTGCACTTAGGGGAGG + Intergenic
1044241339 8:89892439-89892461 AGAACCCGTGCACTTGGAGGAGG + Intergenic
1044385975 8:91588577-91588599 AAAATCAGTGCACTATGGAGAGG + Intergenic
1044635552 8:94320225-94320247 AGAATCTGTGTGCTCAGGGGAGG - Intergenic
1045172662 8:99687654-99687676 AGAATCTGTGCATTTGTGGGCGG - Intronic
1045462116 8:102434353-102434375 ATAATCCCAGCACTTTGGGGAGG + Intergenic
1045592604 8:103614361-103614383 AGAGTCTGTGCACTTAGGGAAGG - Intronic
1045599098 8:103693205-103693227 AGAATCTGTGAACTTATGGAAGG - Intronic
1045621113 8:103979758-103979780 AGAGTCTGTGCATTTGGGAGAGG + Intronic
1045733545 8:105268307-105268329 AGAGAATCTGCACTTTGGGGCGG - Intronic
1046114259 8:109766030-109766052 AGAGTCTGTGCACCTGGAGGAGG - Intergenic
1046149898 8:110210657-110210679 AGAATCTGTGCACTTGAGAGAGG + Intergenic
1046463485 8:114571804-114571826 AGAATCTGTGCTTTTGGGAGAGG - Intergenic
1046811547 8:118538578-118538600 AGAATCTGTGCCCTTTGGAGAGG - Intronic
1047138486 8:122107897-122107919 AGAATCTGTGCACCTGGGGGAGG - Intergenic
1047352542 8:124089331-124089353 AGGATCTGTGCACTTAGGGAAGG - Intronic
1047938092 8:129801182-129801204 AGAATCTGTGTGCTTGGAGGAGG - Intergenic
1048118670 8:131554799-131554821 TGAATCTGTGCACTTGATGGAGG + Intergenic
1049711981 8:144068910-144068932 AGCATCTGTGGACCTGGGGGTGG - Intergenic
1050238937 9:3613654-3613676 AGAATCAGTGCACTTGAGGGAGG - Intergenic
1050248058 9:3712985-3713007 AGAATCTGTGCACTTTGGGGTGG + Intergenic
1050355645 9:4780571-4780593 AGAATCTGTGCATTTGGGAGAGG + Intergenic
1050429265 9:5545256-5545278 AGAATCTGAGCAGTTTGAGTAGG - Intronic
1050508097 9:6368396-6368418 AGAATCTGTGCACTTGAGGGAGG + Intergenic
1050891541 9:10830381-10830403 AGGATCTGTGTTCTGTGGGGAGG + Intergenic
1051047080 9:12888218-12888240 AGAGTCTGTGCACTTGGGAAAGG + Intergenic
1051246445 9:15116600-15116622 AATATCTGTGCACTTTTGGGGGG - Intergenic
1051306615 9:15717161-15717183 GGAATCTGTGCACTTGGGGAAGG + Intronic
1051842460 9:21414007-21414029 AGAATCTGTGCACTTGGGAGAGG - Intronic
1051880142 9:21831581-21831603 ATAATCCCAGCACTTTGGGGAGG - Intronic
1052093878 9:24361713-24361735 AGAATTTGTGCTCTTGGGAGAGG + Intergenic
1052096144 9:24386779-24386801 GGAATCCCAGCACTTTGGGGAGG + Intergenic
1052205021 9:25828537-25828559 AGAATCTGTGCACTTTGGGGAGG - Intergenic
1052442216 9:28511896-28511918 AGCAGCTGTCCACTTTAGGGTGG + Intronic
1052450605 9:28625304-28625326 AGAATCTGTGCACTTGGGAGAGG - Intronic
1052820952 9:33137652-33137674 AGAGTCTGTGGATTTTGGGAAGG + Intronic
1054892585 9:70268187-70268209 GTAATCTGAGCACTTTGGGGAGG + Intronic
1054982460 9:71222737-71222759 AGAATCTGTGTGCTTGGGGAAGG + Intronic
1055227261 9:74014545-74014567 AGAATCTATGTACTTGGGAGAGG + Intergenic
1055580087 9:77699102-77699124 AGAATCTGTGCACTTGGGAGAGG - Intergenic
1055826910 9:80338489-80338511 AGAATCTGTGTGCTTGGGAGAGG + Intergenic
1055867419 9:80832081-80832103 TGAATCTGGGCATTTGGGGGTGG + Intergenic
1055910960 9:81350629-81350651 AGAATCTGTGCACTTTGGGGAGG + Intergenic
1055997341 9:82174560-82174582 AGAATCTGTACTCCTTGGGCCGG + Intergenic
1056141467 9:83684448-83684470 GAAATCTGAGCACTTTGGGAGGG - Intronic
1056230696 9:84539748-84539770 AGAATCTGTGCAACTTGGGGAGG - Intergenic
1058086288 9:100752048-100752070 AGAATCTGTGCACTTGGAGGAGG - Intergenic
1058490974 9:105498871-105498893 GTAATCTTTGCACTTTGGGAGGG - Intronic
1058522920 9:105829462-105829484 AGAATCTGTGAACTTGGGGGAGG - Intergenic
1058641498 9:107090193-107090215 AGAATTTCTGAACTTTGGGAAGG + Intergenic
1058820771 9:108727659-108727681 AGAATCTTTGCACTTGTGGGAGG + Intergenic
1059749140 9:117231574-117231596 GGAATTTGTGGAATTTGGGGAGG + Intronic
1059900726 9:118922133-118922155 AGAATCTCTGTGCTTGGGGGAGG - Intergenic
1060137763 9:121173771-121173793 AGATACTGGGCACATTGGGGAGG + Intronic
1060328584 9:122643283-122643305 AGAATATGTGCACTGTGGGGAGG + Intergenic
1060395615 9:123314343-123314365 AAGATCTGTGTACTTTGGGATGG - Intergenic
1062011768 9:134270983-134271005 ATAATCTCAGCACTTTGGGAGGG + Intergenic
1186317231 X:8384086-8384108 AAAATCTGAGCACTTTGGCTGGG - Intergenic
1186602039 X:11048626-11048648 AGAGTCTGTGATCTTCGGGGAGG - Intergenic
1186882737 X:13882431-13882453 ATAATCTCAGCACTTTGGAGAGG + Intronic
1186882842 X:13883599-13883621 ATAATCTCAGCACTTTGGAGAGG + Intronic
1187575128 X:20546015-20546037 AGAATCTGTCTGCTTGGGGGAGG - Intergenic
1187579424 X:20592526-20592548 AGAATCTGTGCATGCTGGGGAGG - Intergenic
1187594951 X:20760676-20760698 AGAATCTGTGTACTTGGGAGAGG - Intergenic
1187836116 X:23434219-23434241 AGAATCTGTGCACTTGCAGGAGG + Intergenic
1187918288 X:24176333-24176355 AGAATATGTTCACTTTAGGCTGG - Intronic
1188118656 X:26277798-26277820 GGAATCTGTGCAGTTAGGAGAGG - Intergenic
1188421230 X:29992538-29992560 AGAATCTGTGGACTTGCGGGAGG - Intergenic
1188625194 X:32276045-32276067 GGAATCTTTGCACTTTTGGAAGG + Intronic
1188681171 X:33007324-33007346 AGAATATGTACACTCTGAGGAGG - Intronic
1188917982 X:35935391-35935413 AGAATCTGTGCATTTGAGGGAGG - Intronic
1188992350 X:36837568-36837590 AGAATCTGTACACTTGGGTGAGG - Intergenic
1189013569 X:37071721-37071743 AGAATCTGTGCATTTAGGACAGG - Intergenic
1189069299 X:37847288-37847310 CGAATCTCAGGACTTTGGGGTGG + Intronic
1189628048 X:42920717-42920739 AAAATCTGTGTACTGGGGGGAGG + Intergenic
1189854238 X:45208158-45208180 AGAATCTGTGTCCTTGGGGGAGG - Intergenic
1189854522 X:45210231-45210253 AGAATCTGTGTGCTTAGGGGAGG - Intergenic
1189875797 X:45434528-45434550 AGAATCTGTGTACTTGGGGGAGG - Intergenic
1189884956 X:45533104-45533126 AGAGCCTGTGCACTTGGGTGGGG + Intergenic
1190262118 X:48803904-48803926 ATAATCCCAGCACTTTGGGGGGG + Intronic
1190374472 X:49775471-49775493 AGAATCTGTGAACTTGCGGGAGG - Intergenic
1190522899 X:51298415-51298437 AGAATCTGTGCATGTGGGGGAGG + Intergenic
1190537130 X:51440568-51440590 AGAATCTGTGCACTTGGAGGAGG + Intergenic
1190538023 X:51448324-51448346 AGAATCTGTGTGCTTGGAGGAGG - Intergenic
1190588240 X:51968537-51968559 AGACTCTGTGCACTTGGGGGAGG - Intergenic
1190623693 X:52314833-52314855 AGCATATGGGGACTTTGGGGAGG - Intergenic
1190721580 X:53153231-53153253 TGCAGCTGTCCACTTTGGGGTGG + Intergenic
1190798538 X:53767461-53767483 GTAATCTCAGCACTTTGGGGAGG + Intergenic
1190804683 X:53824215-53824237 ATAATCTGTGTACTTTGGAGAGG + Intergenic
1190808474 X:53861689-53861711 ACAATCTGTGTGCTTGGGGGAGG - Intergenic
1190898926 X:54650300-54650322 AGAATCTGAGCACTTGGGAGAGG + Intergenic
1191179055 X:57540096-57540118 AGAATCCATGCACTTGGGGGAGG + Intergenic
1191197056 X:57736007-57736029 AGAGTCTGTGCATTTTGGGGTGG + Intergenic
1191646574 X:63488125-63488147 AGAATCTGTGCATCTGGGGGAGG + Intergenic
1191947025 X:66545376-66545398 AGAATCTGTGCATTTGTGGGAGG - Intergenic
1191990962 X:67036617-67036639 AGAATCTCTGCACTTGGCAGAGG - Intergenic
1191991336 X:67039777-67039799 AGAATCTGTACACTTGCAGGAGG - Intergenic
1192065322 X:67879245-67879267 GGAATCTGTGCTTTCTGGGGAGG + Intergenic
1192134941 X:68588495-68588517 AGAATCTGTGCACTTGCGAGAGG + Intergenic
1192304560 X:69944997-69945019 AGAGAATCTGCACTTTGGGGAGG - Intronic
1192400119 X:70826583-70826605 AGAATCTGTGCACATTGCAGAGG + Intronic
1192677959 X:73219582-73219604 AGAATCTGTACACTCTAGGGAGG + Intergenic
1192793299 X:74405715-74405737 AGAATCTGTGCACTTGGGAAAGG + Intergenic
1192839308 X:74837122-74837144 AGTGTCTGTGCACTTTCAGGAGG - Intronic
1192875351 X:75223665-75223687 ATAATCTGTGCATTTGGGAGAGG - Intergenic
1192890812 X:75389032-75389054 AGACTCTGTGAACTTGGGAGAGG + Intronic
1193052507 X:77116087-77116109 AGAATCTGTGTACTTGGGGGAGG - Intergenic
1193052538 X:77116285-77116307 ATAATCTGTGCACTTGGGGGAGG - Intergenic
1193191228 X:78573316-78573338 AGAATCTGTGCATTTGGGGGAGG - Intergenic
1193293223 X:79803151-79803173 ATAATCTCAGCACTTTGGGAAGG - Intergenic
1193335580 X:80285015-80285037 AGAATCTGTCTGCTTGGGGGAGG + Intergenic
1193580366 X:83257085-83257107 TGAATGTGTGCACTTTGGGTAGG + Intergenic
1193750517 X:85337291-85337313 AGAATCTGTGTGCTTGAGGGAGG - Intronic
1193901504 X:87183415-87183437 AGAATCTGTGCAGTTGAGAGAGG - Intergenic
1194095644 X:89636004-89636026 AGAATCTGTGCACTTGGGGGAGG + Intergenic
1194155439 X:90381866-90381888 AATGTCTGTCCACTTTGGGGAGG + Intergenic
1194196782 X:90903971-90903993 AGAACCTGTGCACTTGGCAGAGG - Intergenic
1194232424 X:91340777-91340799 TGAATCTGTTTACCTTGGGGTGG - Intergenic
1194327795 X:92541372-92541394 AGAGTTTGTGCACTTGGGGGAGG - Intronic
1194329116 X:92559628-92559650 AGAAACTGTGCACTTTAGGGAGG + Intronic
1194370735 X:93068702-93068724 AAAATTTGTGTACTTTTGGGGGG - Intergenic
1194387677 X:93277549-93277571 AAAATCTGTGTGCTTGGGGGAGG + Intergenic
1194415375 X:93605714-93605736 ATAATCTGTGCACTTTTGGGAGG + Intergenic
1194626223 X:96229500-96229522 AGAATCTGTGTGCTTGGGAGAGG + Intergenic
1194842082 X:98754841-98754863 AGAAACTGTGTACTTATGGGAGG - Intergenic
1194937743 X:99971144-99971166 AGATTCTGTGTTCTTGGGGGAGG - Intergenic
1195115632 X:101695683-101695705 AGAATCTGTGCACTTGGGAGAGG + Intergenic
1195199240 X:102532113-102532135 GGAATCTGTGCACTTTGGGTAGG + Intergenic
1195290158 X:103424448-103424470 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
1195595328 X:106682685-106682707 AGAATCTGTGTGCATGGGGGAGG + Intergenic
1195825045 X:108990564-108990586 AGAATCTGTGTGCTTGAGGGAGG - Intergenic
1195872248 X:109498637-109498659 ATAATCTGTGCACTTGGGGAAGG - Intergenic
1196096885 X:111809484-111809506 AGAATCTGTACACTTGGAAGAGG - Intronic
1196153113 X:112396256-112396278 AGAATCTGTGCATTTGGGAGAGG - Intergenic
1196215742 X:113050029-113050051 AGAATCAGTGCACCTAGAGGAGG + Intergenic
1196217705 X:113072688-113072710 AGATTCTGTGCACTTGGTGGAGG - Intergenic
1196270189 X:113700471-113700493 AGAATCCGTGCACATGGAGGAGG - Intergenic
1196385748 X:115147793-115147815 GTAATCTCAGCACTTTGGGGGGG + Intronic
1196485709 X:116204183-116204205 AGAATCTATGCGCTTTGGGGAGG - Intergenic
1196512193 X:116524611-116524633 AGAATCTATGCATGTTGGGGAGG - Intergenic
1196552414 X:117044997-117045019 AGAATCTGTGCACTTTGACAAGG + Intergenic
1197011475 X:121569954-121569976 AGAATCTGTGCAATTCAAGGAGG + Intergenic
1197030598 X:121809212-121809234 AGAATCTGTGTGCTTGGGAGAGG - Intergenic
1197099679 X:122637427-122637449 AGAATCTGTGCACTTAGAGGAGG - Intergenic
1197177959 X:123504760-123504782 AGAATCTGTGCCCTTGGGGGAGG + Intergenic
1197382864 X:125766467-125766489 AGAATATGTACACTTCAGGGAGG - Intergenic
1197399868 X:125977336-125977358 AGAATCTGTGTGCTTGGGGGAGG + Intergenic
1197439217 X:126470261-126470283 AGAATCTGTGTACTTGGAAGAGG + Intergenic
1197457898 X:126700959-126700981 AGAATCTCTGCACTTTGGGAAGG + Intergenic
1197481634 X:126994209-126994231 AGAATCTGTGTGCTTTGGGGAGG + Intergenic
1197487856 X:127075481-127075503 AGAATCTGTGTGCTTGGGGGAGG - Intergenic
1197561816 X:128033739-128033761 AGAAGCTCTGCACTTGGGAGAGG + Intergenic
1197623655 X:128779855-128779877 AGTATCTGTGCACTTAGGGGAGG - Intergenic
1197691958 X:129511205-129511227 AGAAACTGGGCATTTTAGGGGGG - Intronic
1197890180 X:131262428-131262450 AGAATCTGTGCACTTTCCCCTGG - Intergenic
1197953032 X:131918381-131918403 AGAATCTGTGCACTTGGGAAGGG + Intergenic
1198133659 X:133725265-133725287 ATAATCCCAGCACTTTGGGGAGG + Intronic
1198274126 X:135085545-135085567 AGAATCTGTGCACTTGGGGGAGG - Intergenic
1198278067 X:135116220-135116242 AGAGTCTGTGCACTTTGGGGAGG - Intergenic
1198292895 X:135256296-135256318 AGAGTCTGTGCACTTTGGGGAGG + Intronic
1198430940 X:136565537-136565559 AGAATCTGTGCACTTGGGAGAGG - Intergenic
1198515389 X:137401355-137401377 AGAATCTGTGCACTTGAGAGAGG - Intergenic
1198559269 X:137830994-137831016 AGAATCTGTGCACTTTGGGGAGG + Intergenic
1198578400 X:138036356-138036378 AGTATTTGTGCACTTGGGAGAGG + Intergenic
1198628686 X:138609106-138609128 AGAATCTCAGCACTTTGGGAGGG - Intergenic
1198663305 X:138995149-138995171 AGAATCTGTGCACTTGGGAGAGG + Intronic
1198761556 X:140038325-140038347 AGAATCTGTGTCCTTTGGGGAGG + Intergenic
1198770687 X:140126923-140126945 AGAATCTGTGCACTTGGGGGAGG - Intergenic
1199005606 X:142693041-142693063 AGAATTTGTGCTCTTCGGAGAGG + Intergenic
1199277516 X:145963900-145963922 AGAGTCTGTGCATTTGGAGGAGG + Intergenic
1199325088 X:146489913-146489935 AGCAGCTGTGCACTTTGGGGAGG + Intergenic
1199464449 X:148120295-148120317 AGAATCTGTGTCCTTCTGGGAGG + Intergenic
1199568907 X:149247278-149247300 AGAATCTGTGTGCCTGGGGGAGG - Intergenic
1199921127 X:152405146-152405168 AGAATCTGTGTGCTTGGAGGAGG + Intronic
1200135126 X:153871080-153871102 AGAGGCTCTGCACTTGGGGGAGG + Exonic
1200177201 X:154125513-154125535 AGAAGCTGTACACTTGGGGGAGG + Intergenic
1200255394 X:154579682-154579704 AAAATATGTGCATTTTGTGGGGG - Intergenic
1200262375 X:154624722-154624744 AAAATATGTGCATTTTGTGGGGG + Intergenic
1200370094 X:155715887-155715909 AGAATCTTTGCACTTTGGGGAGG - Intergenic
1200448643 Y:3297372-3297394 AGAATCTGTGCACTTGGGGGAGG + Intergenic
1200501787 Y:3958799-3958821 AATGTCTGTCCACTTTGGGGAGG + Intergenic
1200542629 Y:4478172-4478194 AGAACCTGTGCACTTGGCAGAGG - Intergenic
1200636509 Y:5660590-5660612 AGAGTTTGTGCACTTGGGGGAGG - Intronic
1200637818 Y:5678818-5678840 AGAAACTGTGCACTTTAGGGAGG + Intronic
1200678530 Y:6180592-6180614 AAAATTTGTGTACTTTTGGGGGG - Intergenic
1200968121 Y:9120131-9120153 AGAATCTCTGAAATATGGGGAGG - Intergenic
1201677707 Y:16605588-16605610 GTAATCTCTGCACTTTGGGAGGG + Intergenic
1202173164 Y:22072501-22072523 AAAATCTCTGAAATTTGGGGTGG + Exonic
1202218196 Y:22513870-22513892 AAAATCTCTGAAATTTGGGGTGG - Exonic
1202324990 Y:23682185-23682207 AAAATCTCTGAAATTTGGGGTGG + Intergenic
1202545781 Y:25987869-25987891 AAAATCTCTGAAATTTGGGGTGG - Intergenic