ID: 1024705960

View in Genome Browser
Species Human (GRCh38)
Location 7:51959805-51959827
Sequence AGAATCTGTGCACTTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024705960_1024705968 12 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705968 7:51959840-51959862 CGAGGCTCTTGCCAGAGGTTGGG No data
1024705960_1024705969 13 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705969 7:51959841-51959863 GAGGCTCTTGCCAGAGGTTGGGG No data
1024705960_1024705967 11 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705967 7:51959839-51959861 GCGAGGCTCTTGCCAGAGGTTGG No data
1024705960_1024705966 7 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705966 7:51959835-51959857 TGCTGCGAGGCTCTTGCCAGAGG No data
1024705960_1024705970 22 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705970 7:51959850-51959872 GCCAGAGGTTGGGGCAGAAGTGG No data
1024705960_1024705964 -6 Left 1024705960 7:51959805-51959827 CCTCCCCAAAGTGCACAGATTCT No data
Right 1024705964 7:51959822-51959844 GATTCTGCCTCTATGCTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024705960 Original CRISPR AGAATCTGTGCACTTTGGGG AGG (reversed) Intergenic